ID: 1013111847

View in Genome Browser
Species Human (GRCh38)
Location 6:107070521-107070543
Sequence GGTGGACCTGCTCTCCCTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013111847_1013111854 11 Left 1013111847 6:107070521-107070543 CCTCAAGGGAGAGCAGGTCCACC 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1013111854 6:107070555-107070577 CTGGGACATGTTGGACGTGAGGG 0: 1
1: 1
2: 1
3: 12
4: 145
1013111847_1013111848 -8 Left 1013111847 6:107070521-107070543 CCTCAAGGGAGAGCAGGTCCACC 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1013111848 6:107070536-107070558 GGTCCACCTTGCTGTGCAGCTGG 0: 1
1: 1
2: 1
3: 10
4: 161
1013111847_1013111853 10 Left 1013111847 6:107070521-107070543 CCTCAAGGGAGAGCAGGTCCACC 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1013111853 6:107070554-107070576 GCTGGGACATGTTGGACGTGAGG 0: 1
1: 1
2: 1
3: 6
4: 137
1013111847_1013111849 -7 Left 1013111847 6:107070521-107070543 CCTCAAGGGAGAGCAGGTCCACC 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1013111849 6:107070537-107070559 GTCCACCTTGCTGTGCAGCTGGG 0: 1
1: 1
2: 2
3: 19
4: 181
1013111847_1013111852 2 Left 1013111847 6:107070521-107070543 CCTCAAGGGAGAGCAGGTCCACC 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1013111852 6:107070546-107070568 GCTGTGCAGCTGGGACATGTTGG 0: 1
1: 1
2: 2
3: 61
4: 1112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013111847 Original CRISPR GGTGGACCTGCTCTCCCTTG AGG (reversed) Exonic
900374920 1:2349307-2349329 GGTGGAGCACCCCTCCCTTGGGG - Intronic
900581262 1:3410846-3410868 GGTGAACCTGCTCTCCAGGGCGG - Intronic
900829561 1:4956197-4956219 TTTGGCCCTGCTCTCCCTTAAGG - Intergenic
902717611 1:18283306-18283328 GCAGTCCCTGCTCTCCCTTGTGG - Intronic
903012743 1:20342876-20342898 GGCGGATCTGTCCTCCCTTGGGG + Intronic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
905264765 1:36744048-36744070 GGTGGACCTCCCCCACCTTGTGG + Intergenic
905732088 1:40304367-40304389 GGGGGCCCTGCTCCCCCTTAGGG + Exonic
906512020 1:46415426-46415448 CGTGGACCTGCCCTACCTAGAGG - Intergenic
911165396 1:94720187-94720209 GGAGGATTTGCTCTCCCTTTAGG + Intergenic
915789573 1:158653425-158653447 TGGGGATCTGCTCTCCCTTCAGG - Exonic
918102378 1:181387539-181387561 TGAGGAGCAGCTCTCCCTTGGGG - Intergenic
919740704 1:200979760-200979782 GGTGGAGCTGCGCCCCCTAGTGG - Intronic
920215680 1:204360157-204360179 GGTGGCCCTGCTCCCCTTTGGGG - Intronic
922500114 1:226091091-226091113 GGAGGACATGCCCTTCCTTGTGG - Intergenic
922752894 1:228079188-228079210 GGTGGCCCTGCCCTGCCTTCTGG - Intergenic
1062798110 10:359245-359267 GGTGGCCCTGCTCTCCCTGGGGG - Intronic
1066013173 10:31212879-31212901 GGTGTCCCTGCTTCCCCTTGTGG - Intergenic
1066125213 10:32335081-32335103 AGTGGAGCTGCCCTTCCTTGAGG + Intronic
1067032236 10:42885775-42885797 GCTGGACCTGCTGGGCCTTGTGG + Intergenic
1067941172 10:50658702-50658724 AGTGGACCTGCTCTCCCTGAAGG + Intergenic
1069588781 10:69629616-69629638 TGTGGACCTGCTCACCAGTGGGG - Intergenic
1069916977 10:71793225-71793247 GGTAGACCAGCTCCCCATTGAGG - Intronic
1070862393 10:79683574-79683596 AGTGGACCTGCTCTCCCTGAAGG + Intergenic
1073100311 10:101002948-101002970 TGAGGACCGGCTCTTCCTTGTGG + Intronic
1075576847 10:123584065-123584087 GGTGGTCTAGCTCTCCCTTTGGG + Intergenic
1082788055 11:57328185-57328207 GTAGGACCTGTTCTTCCTTGGGG - Intronic
1085390700 11:76180715-76180737 GGTGGACCTGCAAGCCCCTGGGG - Intergenic
1088940828 11:114453955-114453977 GGTGTGCCTGCCCTCCCCTGGGG - Intergenic
1090024823 11:123158502-123158524 GGTGGACCTGCCCTCCTCTATGG + Intronic
1096670859 12:53197592-53197614 GGTGGACCTGTACTACCTTATGG - Exonic
1101754898 12:107613723-107613745 TGAAGACCTGCTCTCCCTGGCGG + Intronic
1101756056 12:107621259-107621281 GGTGCACCTGCTCCCATTTGGGG - Intronic
1102871653 12:116418726-116418748 GGTGGGTCTACTCTCCCTGGAGG - Intergenic
1104990063 12:132619792-132619814 GGCGGGCCAGCTGTCCCTTGCGG + Intronic
1106019966 13:25905076-25905098 GGGTGACGTGCTCTCCCTTCAGG - Intronic
1108041728 13:46345533-46345555 GCTCCACCTGTTCTCCCTTGAGG - Exonic
1110960115 13:81610817-81610839 TGTGCAGCTGCTCGCCCTTGTGG + Intergenic
1111328055 13:86725286-86725308 GGTGGTCCTGCCCACCCTTGTGG + Intergenic
1112975605 13:105313901-105313923 GGTTGACCTGCTCTCACTGAGGG - Intergenic
1113765333 13:112877538-112877560 GCTGCACCTGCTCTCTCTCGGGG - Intronic
1114208763 14:20598154-20598176 GGAGGTCCTGTTCTCCCTTGGGG + Intronic
1114375649 14:22143957-22143979 GGTGATCCTGAGCTCCCTTGAGG + Intergenic
1115566470 14:34629641-34629663 GGTGGACCTCCACTCCCACGCGG - Intronic
1117267424 14:54104374-54104396 GAAGGACCTGCTGTCCCTGGAGG - Intergenic
1119028157 14:71170008-71170030 GGAGGAACTCCTTTCCCTTGGGG + Intergenic
1119601349 14:75979243-75979265 GGTGGACCAGCTCTGGCTGGAGG - Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1122208607 14:100160583-100160605 GGTGGACCTGCTGTGCCTGTGGG + Intergenic
1123155233 14:106218411-106218433 GGTGGTCCTGTTCCCCCTTCAGG + Intergenic
1202858095 14_GL000225v1_random:63948-63970 GGTGGAGCTGCCCCGCCTTGGGG + Intergenic
1123758047 15:23412241-23412263 GGTGGGCTTGCTCTCATTTGTGG + Intergenic
1124216882 15:27815041-27815063 GGAAGCCCTGCTCTCCCTCGGGG - Intronic
1125804888 15:42485345-42485367 TGAGGACCTGCTGTACCTTGTGG - Intronic
1126401862 15:48280059-48280081 GGTTTCCCTGCTCTCCCTTCTGG + Intronic
1126806421 15:52353885-52353907 GGAGCACCTGCTCCTCCTTGCGG + Exonic
1129117152 15:73370747-73370769 GGTGGACCTGCTCCACCCTCAGG - Intergenic
1129725446 15:77899296-77899318 AGTGGACCTCATCTCCATTGCGG - Intergenic
1132905612 16:2281170-2281192 CGTGGACAGGCTCTCCCTCGCGG - Exonic
1142248747 16:88981496-88981518 GGTAGACCTGCTCTTTCTGGGGG - Intergenic
1142278134 16:89133599-89133621 GGTGGCCCTGCTGCCCCTCGTGG + Intronic
1142742604 17:1939915-1939937 GGTGCCCCGGCTCTCCCATGAGG - Intronic
1146852544 17:36235610-36235632 TGTGAACCTGCACTCCCTGGAGG + Intronic
1146868457 17:36359482-36359504 TGTGAACCTGCACTCCCTGGAGG + Intronic
1147071329 17:37960106-37960128 TGTGAACCTGCACTCCCTGGAGG + Intergenic
1147082856 17:38039632-38039654 TGTGAACCTGCACTCCCTGGAGG + Intronic
1147098799 17:38163603-38163625 TGTGAACCTGCACTCCCTGGAGG + Intergenic
1147636628 17:41967938-41967960 GCTGGACCTTCTTTCCCTTTCGG - Intronic
1149338699 17:55664412-55664434 GGTACACATGCTCTCCCTGGAGG + Intergenic
1149838833 17:59939774-59939796 TGTGAACCTGCACTCCCTGGAGG - Intronic
1150080332 17:62232645-62232667 TGTGAACCTGCACTCCCTGGAGG + Intergenic
1150210038 17:63436824-63436846 GGTTGACCCGCTCTTCCTAGAGG - Intronic
1150295049 17:64002981-64003003 GGTGGACTTCCACTCCCTTTTGG - Intronic
1154100840 18:11472082-11472104 GGCTGTCCTGCTCTCCTTTGCGG + Intergenic
1154136717 18:11786164-11786186 GGAGGACCTGCTAACCCTGGAGG + Intronic
1154148021 18:11882310-11882332 GATGGACCTGTTCCCACTTGGGG - Exonic
1155902764 18:31411357-31411379 GGTAGAGCTCCTCTTCCTTGCGG - Exonic
1160017196 18:75154042-75154064 GGTGTCCCTGCTCTCCTCTGGGG + Intergenic
1161593466 19:5139495-5139517 GAGGAAACTGCTCTCCCTTGCGG + Intronic
1162756718 19:12865251-12865273 GGGGGCACAGCTCTCCCTTGAGG + Intronic
1163035199 19:14565742-14565764 AGTGGCCCTGTTCTCCCTGGTGG + Exonic
1166824055 19:45598470-45598492 GCTGGACCGGTTCCCCCTTGAGG - Intronic
1166827065 19:45616368-45616390 GTTGAAGCTGCGCTCCCTTGAGG + Intronic
925068725 2:950484-950506 GGGGCACCTCTTCTCCCTTGTGG - Intergenic
925395793 2:3532929-3532951 GATGGAGCTGCTCACCCTTCGGG + Intronic
928114710 2:28538617-28538639 GGTGGCCCTGCTCTTCCCTAAGG + Intronic
929906615 2:46051522-46051544 GGTGGCTCTGCTCTCCTTTGGGG + Intronic
934606500 2:95699326-95699348 GGTGGGCCTGGCCTCCCCTGAGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936074770 2:109394793-109394815 GGTGGCTCTGCCCTCCCATGTGG - Intronic
937846381 2:126583680-126583702 GGTAGACATGCACTTCCTTGGGG - Intergenic
938104742 2:128522022-128522044 AGAGGACCTCCTCTCCCTGGAGG - Intergenic
938730298 2:134142030-134142052 AGTTCCCCTGCTCTCCCTTGGGG - Intronic
1171376200 20:24695822-24695844 GGTGGACCTGCCCTTGCTTCAGG - Intergenic
1172567004 20:35938596-35938618 GGTGGAGCTGCTGTCCCTACTGG + Intronic
1174546778 20:51331570-51331592 GCTGGCCCTGCTTTCCCCTGGGG - Intergenic
1174572831 20:51514945-51514967 TGTGCACTTCCTCTCCCTTGGGG - Intronic
1175363296 20:58432066-58432088 GAAGGACCTGTTTTCCCTTGGGG + Intronic
1175983580 20:62753385-62753407 TGTGGCTCTGCCCTCCCTTGTGG + Intronic
1180094004 21:45546313-45546335 GAGGGACCTGCGCTCACTTGGGG - Intergenic
1180414195 22:12693701-12693723 GGTGGAGCTGCTCCGGCTTGGGG + Intergenic
1183290986 22:37002002-37002024 GGTGGCCCTGTTCTCTCTCGAGG + Exonic
1184751516 22:46489044-46489066 GGTGGCCCTGCCCTGCCATGGGG - Intronic
1184987210 22:48144058-48144080 GGTGGACCTGTTCTTGCTGGGGG + Intergenic
1185021168 22:48377049-48377071 GGTGCACCTGCCCTCCCCAGAGG - Intergenic
1185116590 22:48941526-48941548 GGGGGACTTGCTGTCCTTTGGGG + Intergenic
952737545 3:36705373-36705395 GGCGGAGCTGCTCTCCCTCCTGG - Intergenic
956928589 3:74016941-74016963 GGTAGATCTGCTCGCCCTTCAGG + Intergenic
959295530 3:104530527-104530549 GGTGGAACAGCTCTCGCTGGGGG + Intergenic
960677551 3:120211203-120211225 GGGCTCCCTGCTCTCCCTTGGGG + Intronic
964475920 3:157097516-157097538 GGTGAATTTGCTCTCCCTTCTGG - Intergenic
967956499 3:194881384-194881406 GGGACACCTGCTCTCCCTGGAGG - Intergenic
970648970 4:18156886-18156908 GGTTTACCTGCTCTTCCTTTAGG + Intergenic
970695190 4:18668605-18668627 GGTGGAGCTCCTCTTCCCTGAGG + Intergenic
976602347 4:86949773-86949795 AGTGGCCCTGTTCTCCCTGGTGG - Intronic
979765789 4:124462970-124462992 AGTGGCCCTGTTCTCCCTGGTGG - Intergenic
980917272 4:139045281-139045303 GGTGTGCCTGCACTCCCCTGAGG - Exonic
981601660 4:146496078-146496100 GGTGGAGCTGACCTCACTTGTGG + Intronic
983901607 4:173141781-173141803 GGTGGTCCTCCACTCCCTGGAGG - Intergenic
986014943 5:3749388-3749410 TGTGGTCCTGCTCTTCCCTGTGG - Intergenic
988737080 5:34033327-34033349 GGTAGCCCTTCTCTCCTTTGGGG + Exonic
998323838 5:141260519-141260541 GGTGAATTTGCTCTCCCTTCTGG + Intergenic
1002979109 6:2117155-2117177 TGTGGAACTGCTCTTACTTGAGG + Intronic
1003111172 6:3253242-3253264 GGTGGAAGTGTTCTCCCTTTGGG + Intronic
1004252249 6:14032426-14032448 GGGAGACCTGCTCTACCTAGAGG + Intergenic
1006223726 6:32518589-32518611 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1006230322 6:32580779-32580801 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1007429216 6:41767083-41767105 GGTGAACCTGCTCTCCCCTGGGG - Intergenic
1011026215 6:82872333-82872355 GTTAGACTTGCTCTACCTTGCGG - Intergenic
1013111847 6:107070521-107070543 GGTGGACCTGCTCTCCCTTGAGG - Exonic
1019353795 7:568589-568611 TGTGGACATTCCCTCCCTTGTGG - Intronic
1019531525 7:1505958-1505980 GGGAGACCAGCTCTGCCTTGCGG - Intergenic
1019540911 7:1550593-1550615 GGTGGACCTGCCCTGGCCTGGGG - Intronic
1020281765 7:6653504-6653526 GGGGGGCCCGCTCTCCCTGGTGG + Exonic
1023997983 7:45173776-45173798 AGGGCACCTGCTTTCCCTTGGGG + Intronic
1024065241 7:45727007-45727029 GCTGGGCCTGCTGTCCCTCGCGG + Intergenic
1024732174 7:52264870-52264892 GGGGGACTTGCTCTCCAGTGGGG - Intergenic
1035051667 7:156002337-156002359 GTTGGAGCTGCCTTCCCTTGTGG + Intergenic
1036649757 8:10634782-10634804 GGTGGACTTGCTCTACCTGAAGG - Intronic
1037787568 8:21911865-21911887 GGCTGCCCTGCTCTCCCCTGGGG - Intronic
1042054354 8:64748232-64748254 GGTGGAGCTCTTCACCCTTGGGG + Intronic
1044406623 8:91834180-91834202 GCTGGACTTGTTCTCTCTTGGGG - Intergenic
1049422807 8:142524394-142524416 TGTGCACCTGCTGTCCCTTCAGG + Intronic
1054834831 9:69666211-69666233 GGTTTCCCTGCTGTCCCTTGAGG + Intronic
1055395205 9:75866868-75866890 GGTAGAACTGCTCTCCGATGTGG - Intergenic
1056203737 9:84300675-84300697 GAGGGACCTCCTCTCCCTTCAGG - Intronic
1056938657 9:90937030-90937052 GGTGGACCTGGTGTCACTGGAGG + Intergenic
1057645958 9:96875635-96875657 GGTGGAGCTGCGCCCCCTTTAGG - Intergenic
1059361972 9:113751415-113751437 GTTGTAACTGTTCTCCCTTGGGG + Intergenic
1188800852 X:34527955-34527977 GCTGGACCTGCCCTCACTTACGG + Intergenic
1189310245 X:40013396-40013418 GGTGAACCTCCTCTTCCTCGTGG - Intergenic
1190141291 X:47847473-47847495 GGTGGGGCTGCTCTCACTTCTGG + Intronic
1192716549 X:73648193-73648215 TTTGGAGCTGCTGTCCCTTGGGG - Intronic
1193613477 X:83659852-83659874 GAGGGGCCTGCTCTTCCTTGTGG - Intergenic
1193925836 X:87482916-87482938 GCTGGTCCTTGTCTCCCTTGTGG - Intergenic
1195867865 X:109452849-109452871 GGTGGAACTCCTCTAGCTTGTGG - Intronic
1199148768 X:144404116-144404138 GTTGTACTTTCTCTCCCTTGGGG + Intergenic
1201577688 Y:15478429-15478451 GGAGGAGCTCCTCTGCCTTGTGG + Intergenic