ID: 1013112162

View in Genome Browser
Species Human (GRCh38)
Location 6:107072771-107072793
Sequence GCTCAGAAGTTCCGCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013112155_1013112162 16 Left 1013112155 6:107072732-107072754 CCCAGCACTTTGGGAGGCCAAGA 0: 5583
1: 99313
2: 221046
3: 234614
4: 143836
Right 1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG 0: 1
1: 0
2: 2
3: 13
4: 246
1013112156_1013112162 15 Left 1013112156 6:107072733-107072755 CCAGCACTTTGGGAGGCCAAGAT 0: 2089
1: 36048
2: 135265
3: 227170
4: 201712
Right 1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG 0: 1
1: 0
2: 2
3: 13
4: 246
1013112160_1013112162 -1 Left 1013112160 6:107072749-107072771 CCAAGATGGGTGGATCTCCTGAG 0: 9
1: 835
2: 14117
3: 38735
4: 69666
Right 1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG 0: 1
1: 0
2: 2
3: 13
4: 246
1013112153_1013112162 24 Left 1013112153 6:107072724-107072746 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG 0: 1
1: 0
2: 2
3: 13
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013112162 Original CRISPR GCTCAGAAGTTCCGCCAGCC TGG Intronic
900116049 1:1028345-1028367 GCCCACAGGTGCCGCCAGCCAGG - Intronic
900479649 1:2891838-2891860 GCTCAGAACTGGAGCCAGCCAGG + Intergenic
900648573 1:3720130-3720152 GGTCAGGAGTTCGACCAGCCTGG - Intronic
901693622 1:10990528-10990550 GCTCAGGAGTTGGACCAGCCCGG + Intergenic
903579537 1:24360371-24360393 GCTCACAACTTCCGCCTCCCAGG - Intronic
904119776 1:28190202-28190224 CCTCAGATGATCCGCCTGCCTGG + Intronic
904365744 1:30010061-30010083 GGTCAGAAGTTCTGGCAGTCTGG + Intergenic
904831903 1:33310897-33310919 GCCCAGCAGTTCTGCCCGCCTGG + Intronic
905306716 1:37024531-37024553 GGTCAGGAGTTCGACCAGCCTGG + Intronic
905880822 1:41462806-41462828 GCTCAAGAGTTCCCCCTGCCTGG + Intergenic
907356979 1:53883824-53883846 GGTCAGGAGTTCGACCAGCCTGG + Intronic
907828938 1:58045528-58045550 TCTCAGAAGTTCCCCCAGGATGG - Intronic
908215842 1:61950912-61950934 GCTCAGGTGATCCGCCCGCCTGG - Intronic
909925163 1:81430123-81430145 CCTCAGGTGATCCGCCAGCCTGG + Intronic
910323030 1:85970999-85971021 GGCCAGAAGTTCGGCCAGCCTGG + Intronic
911199330 1:95028583-95028605 CCTCAGAAGATCCACCTGCCTGG - Intronic
914313318 1:146486721-146486743 GCTCAGTAGTCCTGCCAGGCGGG - Intergenic
914347269 1:146810536-146810558 CCTCAGATGATCCGCCTGCCTGG - Intergenic
914501031 1:148246660-148246682 GCTCAGTAGTCCTGCCAGGCGGG + Intergenic
914844413 1:151273902-151273924 GGTCAGGAGTTCTGCCACCCAGG - Intergenic
915110591 1:153562351-153562373 GCCCAGGAGTTCGACCAGCCTGG - Intronic
915134300 1:153719283-153719305 GCCCAGGAGTTCAACCAGCCTGG - Intergenic
915285730 1:154850800-154850822 GCTCAGAAGCTCCCCCAGTGTGG - Intronic
915907720 1:159890989-159891011 CCTCAGATGATCCGCCCGCCTGG + Intronic
916621838 1:166506211-166506233 GCTCAGGAGTTTGACCAGCCTGG - Intergenic
918499052 1:185173481-185173503 GCCCAGGAGTTCGACCAGCCTGG + Intronic
919822694 1:201482962-201482984 GCTCAGAACTTCTCCCAGCTCGG - Intergenic
922417500 1:225434829-225434851 GGTCAGGAGTTTGGCCAGCCTGG + Intergenic
922484089 1:225959750-225959772 GCTCAGAAGGTCAAGCAGCCTGG + Intergenic
924880936 1:248162015-248162037 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
1065921320 10:30395499-30395521 GGTCAGGAGTTCGGCCAGCATGG - Intergenic
1069454266 10:68541295-68541317 GGTCAGGAGTTCAACCAGCCTGG - Intergenic
1069455342 10:68549586-68549608 GCTCAGGAGTTCGACCAGCCTGG + Intergenic
1069482458 10:68796152-68796174 GCTCAGGAGTTCCAGTAGCCTGG - Intergenic
1070239782 10:74667744-74667766 GGTCAGGAGTTCAGCCAGCCTGG - Intronic
1072081023 10:92032223-92032245 GGTCAGGAGTTCAACCAGCCTGG - Intergenic
1072446997 10:95507698-95507720 GATCAGAAGTTCGAGCAGCCTGG + Intronic
1074720797 10:116263489-116263511 GCTCTGGAGTTCCACCAACCTGG - Intronic
1075507016 10:123032819-123032841 CCTCAGATGATCCGCCCGCCTGG + Intronic
1077487895 11:2847437-2847459 GCACAGAAGGCCGGCCAGCCTGG + Intronic
1078539933 11:12205199-12205221 GCTCTGATGTTCCTCAAGCCTGG + Intronic
1079031362 11:16988655-16988677 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1081631305 11:44691900-44691922 GGTCAGGAGTTCAACCAGCCTGG + Intergenic
1082985856 11:59170897-59170919 GCTCAGAGGTTCCTTGAGCCTGG + Intergenic
1083260587 11:61520611-61520633 GGTCAGGAGTTCAACCAGCCTGG + Intronic
1083657450 11:64236331-64236353 GCTCAGAAGTTGGGCCTGGCTGG - Intronic
1084541002 11:69787150-69787172 CCTCAGGTGTTCCGCCTGCCTGG - Intergenic
1085041123 11:73326991-73327013 GCTCAGAAGGGCAACCAGCCAGG + Intronic
1086508517 11:87530044-87530066 TGTCAGAAGTTCCAGCAGCCTGG + Intergenic
1088466324 11:110143731-110143753 GCCCAGGAGTTCAACCAGCCTGG - Intronic
1088692123 11:112337087-112337109 GCCCAGGAGTTCGACCAGCCAGG + Intergenic
1093323544 12:17744039-17744061 GGTCAGGAGTTCAACCAGCCTGG + Intergenic
1093724007 12:22481841-22481863 GCCCAGAAGTTAGACCAGCCCGG - Intronic
1098286449 12:68912214-68912236 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1098649567 12:72947498-72947520 GCTCAGGAGTTCGAGCAGCCTGG - Intergenic
1100240037 12:92701980-92702002 GGTCAGGAGTTCGGACAGCCTGG + Intergenic
1100247961 12:92783151-92783173 GGTCAGAAGTTCTGGAAGCCTGG + Intronic
1101405285 12:104423209-104423231 GCCCAGAAGTTCAACCAGCCTGG - Intergenic
1101689311 12:107060900-107060922 GCTCACAACTTCCGCCTCCCGGG - Intronic
1101772817 12:107767248-107767270 GGTCAGAAGTTCCACAGGCCTGG - Intergenic
1102115507 12:110399882-110399904 GGTCAGGAGTTCGACCAGCCTGG + Intronic
1103222595 12:119258214-119258236 GCTCAGAATTTCCCCCGGACTGG + Intergenic
1103539711 12:121657633-121657655 CCTCAGGTGATCCGCCAGCCTGG - Intronic
1105016649 12:132789819-132789841 GGTCAGGAGTTCAACCAGCCTGG + Intronic
1105808623 13:23974032-23974054 GCTCAAGCGATCCGCCAGCCTGG + Intergenic
1107697034 13:43010580-43010602 GCACAGAGTTTCCGCCAGCTGGG + Intergenic
1109041167 13:57338840-57338862 GGTCAGAAGTTCCGGAGGCCTGG + Intergenic
1112706062 13:102069889-102069911 GGTCAGGAGTTCCACCCGCCAGG - Intronic
1113540918 13:111108680-111108702 GGTCAGGAGTTCCACCAGCATGG + Intergenic
1115100694 14:29694998-29695020 ACTCAGGTGATCCGCCAGCCTGG - Intronic
1116164864 14:41322664-41322686 GCTCAGAAGTTCTGGAGGCCTGG + Intergenic
1120800731 14:88685680-88685702 GCTCAGGAGTTCCACCCACCTGG + Intronic
1123804984 15:23861257-23861279 GCGCAGGAGTTCAGCCAGGCTGG - Intergenic
1126510405 15:49465345-49465367 GCTCAGGAGTTCGAGCAGCCTGG - Intronic
1128258225 15:66213851-66213873 GCTGAGAAGTGCCTCCACCCAGG + Intronic
1128730292 15:70016036-70016058 GCTCAGGATTTCTCCCAGCCTGG + Intergenic
1129616528 15:77103354-77103376 GCTCAAAAGTTAGACCAGCCTGG - Exonic
1132762970 16:1519919-1519941 GCTCTGCAGCTGCGCCAGCCTGG + Exonic
1133025657 16:2987998-2988020 GCTCAGATGTCCCCCCAGCAAGG - Intergenic
1133896301 16:9932592-9932614 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1134275703 16:12774256-12774278 GGTCAGGAGTTCAACCAGCCTGG + Intronic
1134828419 16:17303334-17303356 GCTAAGCAGTTCTGCCAGCGTGG - Intronic
1135140551 16:19917711-19917733 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1135712356 16:24729085-24729107 ACTCAGCAGTTCCGCCTGCACGG - Intergenic
1136615317 16:31394888-31394910 GCCCAGGAGTTCAGCCAGTCTGG - Intronic
1139986719 16:70904732-70904754 CCTCAGATGATCCGCCTGCCTGG + Intronic
1142050639 16:87955935-87955957 GCTCAGAATTTCCTGCAGGCAGG + Intronic
1142524743 17:532178-532200 CCTCAGATGATCCGCCTGCCTGG + Intronic
1143080205 17:4375967-4375989 GGCCAGAAGTTCGACCAGCCTGG + Intergenic
1143080385 17:4377110-4377132 GGCCAGAAGTTCGACCAGCCTGG - Intergenic
1143533493 17:7521052-7521074 GGTCAGGAGTTCTACCAGCCTGG + Intergenic
1144119543 17:12137554-12137576 GCTGAGACGTTCCCCCAGCATGG + Intronic
1144235920 17:13260444-13260466 GCACAGAATTTCAGCCAGACAGG - Intergenic
1144938048 17:18916027-18916049 GCTCAGGAGTTCAACCAGCCTGG - Intronic
1145027506 17:19479483-19479505 GCTCAGGAGTTGGACCAGCCTGG - Intergenic
1145754668 17:27381637-27381659 GCCCAGTAGTTCAACCAGCCTGG + Intergenic
1146345458 17:32057644-32057666 GCTCAGCAGTTAAGCCAGACGGG + Intergenic
1146884369 17:36461386-36461408 GCTCAGAAGTTCCAGCAGAAGGG + Intergenic
1146906331 17:36620682-36620704 GCTCAAAGGTTCAGCCAGCAGGG + Intergenic
1147844908 17:43398337-43398359 GCTCAGGAGTTCCACCAGCCTGG - Intergenic
1150692697 17:67378664-67378686 GCTCAGAGGTTCCTCCCGCGGGG - Intronic
1151828927 17:76538359-76538381 GCGCTCAAGTTCCGACAGCCGGG - Intronic
1156250648 18:35349166-35349188 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1156417149 18:36908551-36908573 GCTCAAAAGTTCAATCAGCCTGG - Intronic
1156813643 18:41282197-41282219 GGTCAGAAGTTCCGAAGGCCTGG - Intergenic
1157527013 18:48391235-48391257 GCTCAGCACTTCAGCCTGCCGGG - Intronic
1157589766 18:48829328-48829350 ACTCAGAAAGTCCCCCAGCCTGG - Intronic
1158596723 18:58823146-58823168 GGTCAGAAGTTTGACCAGCCTGG - Intergenic
1159796554 18:72851177-72851199 CCTCAGGTGATCCGCCAGCCTGG - Intronic
1159899664 18:74034128-74034150 GCTGAGCAGTTCTTCCAGCCTGG - Intergenic
1160668242 19:343725-343747 GCGCAGAAGTTACGACAGGCGGG - Intronic
1160701250 19:508481-508503 GCTCAGAACTGGCCCCAGCCAGG - Intronic
1160776143 19:856795-856817 CCTCAGATGATCCGCCTGCCTGG - Intergenic
1161169760 19:2806956-2806978 GCCCAGAAGTCCCGCCTGCTGGG + Exonic
1162663413 19:12189564-12189586 GGTCAGGAGTTCTACCAGCCTGG - Exonic
1162990426 19:14298427-14298449 GCTCAGCAGTTAAGCCAGACGGG - Intergenic
1164036760 19:21462755-21462777 CCTCAGATGATCCGCCTGCCTGG - Intronic
1164613392 19:29648952-29648974 GGTCAGGAGTTCAACCAGCCTGG - Intergenic
1165218312 19:34293604-34293626 GCCCAGAAGTTCAACCAGCCTGG - Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1166779020 19:45330450-45330472 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
1166786954 19:45373363-45373385 GCTCAGGAGTTCAACCAGCCTGG - Intergenic
1167928381 19:52842910-52842932 GGTCAGGAGTTCAACCAGCCTGG + Intronic
1168356021 19:55700471-55700493 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1168410325 19:56135867-56135889 GATCAGAAGATCGACCAGCCTGG + Intronic
928121305 2:28585606-28585628 GGTCAGCAGGTCAGCCAGCCAGG + Intronic
928945871 2:36771314-36771336 GGTCAGAAGTTCGACCAGTCTGG + Intronic
932340649 2:70960927-70960949 GCTCAGATCTGCCGCCAGGCGGG + Exonic
933159970 2:79013034-79013056 GCTCAGGAGTTCCTCATGCCTGG + Intergenic
933744505 2:85561062-85561084 GCTCAGAGCTTCCGCCCACCCGG + Intronic
936737388 2:115462939-115462961 GCTCAGAAGTTTGAGCAGCCTGG - Intronic
939990560 2:148874700-148874722 ACTCAGTTGTTCTGCCAGCCCGG + Intergenic
941420441 2:165277681-165277703 GCTCAGAACTTCTTCAAGCCTGG + Intronic
941943772 2:171072400-171072422 GGTCAGAAGTTCGACCAGCCTGG + Intronic
942393689 2:175523870-175523892 GCTCAAGTGTTCCTCCAGCCTGG + Intergenic
943025876 2:182627745-182627767 TCTCACAAGTTTGGCCAGCCTGG - Intergenic
945964591 2:216172678-216172700 GGTCAGGAGTTCAACCAGCCTGG - Intronic
946625499 2:221608251-221608273 GCTCAGATGATCCACCCGCCTGG + Intergenic
946626011 2:221613086-221613108 GCTCAGATGATCCGCCCACCTGG + Intergenic
1169531274 20:6487797-6487819 GATCAGGAGTTCCAGCAGCCTGG + Intergenic
1170162665 20:13330164-13330186 GGTCAGGAGTTCAGACAGCCTGG - Intergenic
1171213265 20:23333532-23333554 GCTCTGCAGACCCGCCAGCCAGG - Intergenic
1171891798 20:30724281-30724303 TCTCAGGAGCGCCGCCAGCCCGG + Intergenic
1172415795 20:34766403-34766425 GCCCAGGAGTTCAACCAGCCTGG + Intronic
1172977048 20:38913957-38913979 CCTCAGATGATCCGCCTGCCTGG - Intronic
1173010386 20:39176637-39176659 GCTCAGCAATTCCTCCATCCAGG - Intergenic
1173518822 20:43684136-43684158 GCCCAGAAGTTCAACCAGCCTGG - Intronic
1174307781 20:49626676-49626698 GGTCAGAAGTTCTGGAAGCCTGG - Intergenic
1174447816 20:50602298-50602320 CCTCCTAAGTTCCTCCAGCCAGG + Exonic
1175280275 20:57799608-57799630 GCACAGAAGTTCCTCCATGCAGG + Intergenic
1178497522 21:33099796-33099818 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
1182325410 22:29508997-29509019 GGCCAGGAGTTCCACCAGCCTGG - Intronic
1184263981 22:43336873-43336895 GCTCAGATTTTCCGCCTGCCTGG - Intronic
1184306281 22:43604597-43604619 GTCCAGAGGTTCCACCAGCCAGG + Intronic
950135786 3:10579953-10579975 GCTCAGAACTTCCACCTGCCAGG - Intronic
950388547 3:12678419-12678441 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
950609569 3:14117251-14117273 CCTCAGACCTTCCGGCAGCCAGG - Intronic
952059929 3:29495627-29495649 GGTCAGGAGTTCAACCAGCCTGG - Intronic
954474373 3:50730008-50730030 TATCAGAAATTCGGCCAGCCTGG - Intronic
954653137 3:52177484-52177506 GCTCAGATCTTGAGCCAGCCGGG - Intergenic
955244855 3:57215555-57215577 GGTCAGCAGTTCGACCAGCCTGG + Intronic
955372280 3:58362925-58362947 GCTCAGGAGTTCAACCAACCTGG - Intronic
956417707 3:69051263-69051285 AGTCAGGAGTTCCACCAGCCTGG + Intronic
957395962 3:79638510-79638532 CCTCAGGTGATCCGCCAGCCTGG + Intronic
959095805 3:101954172-101954194 GCTCAGGAGTTCGAGCAGCCTGG - Intergenic
961547320 3:127644316-127644338 GGTCAGGAGTTCAGTCAGCCTGG - Intronic
962793551 3:138832457-138832479 GCTCAAATGATCCGCCAGCCTGG - Intronic
968837718 4:2977645-2977667 ACTCAGAACTTCTGCCAGCCTGG - Intronic
969696483 4:8737954-8737976 GCTCAGCTGTCTCGCCAGCCTGG - Intergenic
969706954 4:8817247-8817269 GCTCAGAAGCTCTTCCACCCAGG + Intergenic
969706967 4:8817303-8817325 GCTCAGAAGCTCTTCCACCCAGG + Intergenic
969707012 4:8817521-8817543 GCTCAGAAGCTCTTCCACCCAGG + Intergenic
969707023 4:8817576-8817598 GCTCAGAAGCTCTTCCACCCAGG + Intergenic
972767320 4:42163416-42163438 GCTCAGGAGCTCAGCTAGCCTGG + Intergenic
974406639 4:61480572-61480594 GGTCAGGAGTTCGACCAGCCTGG + Intronic
974514930 4:62897038-62897060 GCTCAGAAGTGCCTGCACCCTGG + Intergenic
975430866 4:74289365-74289387 GCTCATAAAAACCGCCAGCCAGG - Intronic
975605562 4:76150695-76150717 GCCTAGGAGTTCAGCCAGCCTGG + Intergenic
978212595 4:106156461-106156483 GGGCAGAAGTTCCTCCAGGCAGG + Intronic
979290937 4:118977901-118977923 ACTCAGGAGTTCTGCAAGCCTGG + Intronic
980251874 4:130326441-130326463 ACTCAGGACTTCAGCCAGCCTGG + Intergenic
981568920 4:146131398-146131420 CCTCAGAACTTCCAGCAGCCTGG + Intergenic
981646898 4:147009325-147009347 GCTCAGTAGTTTGACCAGCCTGG + Intergenic
982707089 4:158722601-158722623 GCTCAGAAGTTCCTAAGGCCTGG - Intronic
984030969 4:174603636-174603658 GCCCAGGAGTTCAACCAGCCTGG - Intergenic
984905426 4:184621536-184621558 GGTCAGAAGTGCAGGCAGCCAGG + Intergenic
993226941 5:85179265-85179287 GCTCAGGAAATCCACCAGCCGGG - Intergenic
993369219 5:87071563-87071585 GCCCGGAAGTTCGACCAGCCTGG - Intergenic
995641992 5:114267422-114267444 ACTCAAAAGTTCCCCCAGCAAGG - Intergenic
996061042 5:119033632-119033654 GATCAGGAGTTCGACCAGCCTGG + Intergenic
997533972 5:134601832-134601854 GGTCAGAAGTTCGACAAGCCTGG + Exonic
999157933 5:149471895-149471917 GGTCAGCAGTTCCAGCAGCCAGG - Intergenic
999256443 5:150212250-150212272 GCTCAGAACAGCCCCCAGCCTGG + Intronic
1001627266 5:173146265-173146287 GCTCATAAGTTGCTACAGCCAGG + Intronic
1002041060 5:176514579-176514601 GCTCAGGAGTTTGACCAGCCTGG + Intergenic
1002141567 5:177143991-177144013 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1003018979 6:2493595-2493617 GATCAGAGATTGCGCCAGCCTGG - Intergenic
1003556201 6:7141977-7141999 CCTCAGATGATCCGCCTGCCTGG - Intronic
1004394422 6:15235596-15235618 GGTCAGAAGTTCCACAGGCCCGG - Intergenic
1004536955 6:16512163-16512185 CCTCAGAAGTTCTGCCACCACGG + Intronic
1010426525 6:75734317-75734339 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1012662783 6:101923686-101923708 GCTCAGACAATCCGCCTGCCTGG - Intronic
1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG + Intronic
1016031199 6:139340337-139340359 CCTCAGGTGATCCGCCAGCCTGG + Intergenic
1016819931 6:148337592-148337614 GCTCAGGTGATCCGCCTGCCTGG + Intronic
1016841702 6:148532277-148532299 GTCCAGGAGTTCCACCAGCCTGG - Intronic
1016929673 6:149391750-149391772 GCCCAGGAGTTTCACCAGCCTGG - Intronic
1018060693 6:160087448-160087470 GCTCAGAAGCTCAGCAACCCAGG + Intronic
1018762559 6:166904520-166904542 GCTCAGAAGTGCTGACAGCAGGG + Intronic
1019738986 7:2663533-2663555 GCTCAGAATGTCAGCCAGGCGGG - Exonic
1020245748 7:6428133-6428155 GGTCAGGAGTTCGACCAGCCTGG + Intronic
1020290346 7:6718100-6718122 CCTCAGATGATCCGCCTGCCTGG + Intergenic
1023410617 7:39885864-39885886 CCTCAGATGATCCGCCTGCCTGG - Intergenic
1025168670 7:56736140-56736162 GATCAGGAGTTCAACCAGCCTGG - Intergenic
1025703718 7:63843742-63843764 GATCAGGAGTTCAACCAGCCTGG + Intergenic
1026825032 7:73576354-73576376 GCCCAGGAGTTCCACCAGTCTGG + Intronic
1027340838 7:77206403-77206425 GGTCAGGAGTTCAACCAGCCCGG + Intronic
1029367121 7:100123729-100123751 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1029368249 7:100130270-100130292 GGTCAGGAGTTCAACCAGCCTGG - Intergenic
1029703057 7:102260319-102260341 GCTCAGAAGATCCACCCACCTGG + Intronic
1031998032 7:128245740-128245762 GCTCAGGAGGCCCTCCAGCCTGG + Intronic
1033187489 7:139241783-139241805 GGTCAGGAGTGCAGCCAGCCTGG + Intronic
1035059193 7:156056638-156056660 GCTCAGCAGCTCTGCCATCCTGG + Intergenic
1037830541 8:22186066-22186088 CCTCAGGCGATCCGCCAGCCTGG + Intronic
1037968848 8:23156776-23156798 GCTCAGGAGTTAGACCAGCCTGG - Intronic
1038138081 8:24812505-24812527 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1038227945 8:25673954-25673976 GCACAGAAGTTCAGCAAGGCAGG + Intergenic
1038751707 8:30302078-30302100 ACTCAGAAGTTCCCCTAACCAGG + Intergenic
1038977365 8:32715164-32715186 GCACAGGAGTTCAACCAGCCTGG - Intronic
1039749247 8:40461946-40461968 GCTCAGAGGTTCCTCTAGGCTGG + Intergenic
1041091624 8:54306820-54306842 GCTCAAATGATCCGCCTGCCTGG - Intergenic
1043146089 8:76656911-76656933 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1043559009 8:81468930-81468952 GGTCAGAAGTTCCAGCGGCCTGG - Intergenic
1045524585 8:102930764-102930786 GCTCAGGAGTTCCACCAGCCTGG - Intronic
1045598305 8:103683194-103683216 GCTCAGAAGTTCAAGAAGCCTGG + Intronic
1047888465 8:129279502-129279524 CCTCAGGTGATCCGCCAGCCTGG + Intergenic
1049467127 8:142756729-142756751 GCCCAGAAGCCCCGCGAGCCAGG + Intergenic
1049683510 8:143930211-143930233 GCTCAGCAGCTCCGGCAGCGAGG - Exonic
1050823585 9:9914567-9914589 CCTCAGCTGTTCAGCCAGCCTGG - Intronic
1051834935 9:21324945-21324967 CCTCAGATGATCCGCCTGCCTGG - Intergenic
1052678721 9:31660271-31660293 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
1052780942 9:32782008-32782030 GCTGAGAAGTTCAGTAAGCCGGG - Intergenic
1052784032 9:32812205-32812227 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1053366846 9:37528833-37528855 GCACAGAAGTACCCCCAGGCAGG - Intronic
1056011514 9:82335734-82335756 GCTCAGAAATTACTCCAGTCTGG - Intergenic
1056351493 9:85753540-85753562 GGTCAGGAGTTCGACCAGCCTGG + Intergenic
1057505884 9:95633017-95633039 GCTCACAAGTTCCGTCTTCCTGG - Intergenic
1057899097 9:98933833-98933855 GGTCAGGAGTTCGACCAGCCTGG - Intergenic
1058508549 9:105691576-105691598 GTTCAGGAGTTCGACCAGCCTGG + Intergenic
1059088325 9:111329001-111329023 GCTCAGGAGTTTGACCAGCCTGG + Intergenic
1059585373 9:115600363-115600385 GATCAGAAGTTCCTTCAGGCCGG + Intergenic
1060510645 9:124229535-124229557 GGTCAGAAGTTAGACCAGCCTGG - Intergenic
1060568299 9:124613916-124613938 GCTCTGTAGTTGCCCCAGCCAGG - Intronic
1060723978 9:125995400-125995422 GCTCTGAGGTACAGCCAGCCTGG - Intergenic
1061509364 9:131051036-131051058 GGTAAGAAATTCCCCCAGCCAGG + Intronic
1062676251 9:137746324-137746346 GCCCAGGAGTTCAACCAGCCTGG - Intronic
1186885878 X:13913362-13913384 GCCCAGGAGTTCGACCAGCCTGG - Intronic
1187185157 X:16977501-16977523 GCCCAGGAGTTCAACCAGCCTGG + Intronic
1189301750 X:39957258-39957280 GCTCAGGAGATCCTCCTGCCTGG - Intergenic
1193016463 X:76739129-76739151 GTTGACAAGTTCCCCCAGCCTGG - Intergenic
1194737875 X:97535659-97535681 GGTCAGGAGTTCGACCAGCCTGG - Intronic
1197929466 X:131679672-131679694 CCTCAGGTGATCCGCCAGCCTGG + Intergenic