ID: 1013120391

View in Genome Browser
Species Human (GRCh38)
Location 6:107135600-107135622
Sequence CCACCATGCCCGGCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2164
Summary {0: 2, 1: 2, 2: 48, 3: 409, 4: 1703}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013120381_1013120391 18 Left 1013120381 6:107135559-107135581 CCCACCTCAGCCTCCGAAAGTGC 0: 223
1: 33525
2: 138993
3: 237714
4: 237837
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703
1013120382_1013120391 17 Left 1013120382 6:107135560-107135582 CCACCTCAGCCTCCGAAAGTGCT 0: 453
1: 63831
2: 151948
3: 157505
4: 115103
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703
1013120386_1013120391 8 Left 1013120386 6:107135569-107135591 CCTCCGAAAGTGCTGGGATTACA 0: 2099
1: 301438
2: 269274
3: 150602
4: 138910
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703
1013120380_1013120391 21 Left 1013120380 6:107135556-107135578 CCACCCACCTCAGCCTCCGAAAG 0: 163
1: 25236
2: 79941
3: 167267
4: 190989
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703
1013120384_1013120391 14 Left 1013120384 6:107135563-107135585 CCTCAGCCTCCGAAAGTGCTGGG 0: 611
1: 89327
2: 212360
3: 238173
4: 277115
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703
1013120388_1013120391 5 Left 1013120388 6:107135572-107135594 CCGAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG 0: 2
1: 2
2: 48
3: 409
4: 1703

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013120391 Original CRISPR CCACCATGCCCGGCTAAAAC AGG Intergenic
Too many off-targets to display for this crispr