ID: 1013130016

View in Genome Browser
Species Human (GRCh38)
Location 6:107223761-107223783
Sequence GCTCTTGGTGGGTCGGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013130016 Original CRISPR GCTCTTGGTGGGTCGGGGTC GGG (reversed) Intronic