ID: 1013130813

View in Genome Browser
Species Human (GRCh38)
Location 6:107230909-107230931
Sequence TAGGTTAAGAATTCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013130809_1013130813 30 Left 1013130809 6:107230856-107230878 CCAAATTTAGTGGTTTAAAGCAA 0: 1
1: 9
2: 45
3: 202
4: 669
Right 1013130813 6:107230909-107230931 TAGGTTAAGAATTCAGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013130813 Original CRISPR TAGGTTAAGAATTCAGGAGG CGG Intronic
No off target data available for this crispr