ID: 1013135416

View in Genome Browser
Species Human (GRCh38)
Location 6:107277595-107277617
Sequence CCCTTTTGTTGCATCTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013135416_1013135420 6 Left 1013135416 6:107277595-107277617 CCAAGGAAGATGCAACAAAAGGG 0: 1
1: 0
2: 3
3: 15
4: 236
Right 1013135420 6:107277624-107277646 CTAGGACACCGCCTTAGACATGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013135416 Original CRISPR CCCTTTTGTTGCATCTTCCT TGG (reversed) Intronic
900463953 1:2814889-2814911 TTCTTTTCCTGCATCTTCCTGGG + Intergenic
900853270 1:5160734-5160756 CCCTTTTTGTGCTTCTTCATAGG + Intergenic
901741015 1:11341931-11341953 CCCTTTGGTTCCAGCATCCTGGG + Intergenic
903056176 1:20637783-20637805 CCCTTTTCTTGGGCCTTCCTAGG + Intronic
904388332 1:30162100-30162122 CCCTCTTGGTGCAGCTTCCCTGG - Intergenic
904975212 1:34450963-34450985 CCCTTTTGTTGAAGTTACCTAGG + Intergenic
905114027 1:35621773-35621795 ACCTTGTGATGCATCTGCCTTGG - Intronic
906453690 1:45975132-45975154 CCCTGTGGATGCAGCTTCCTTGG - Intronic
909020104 1:70421440-70421462 GCTTTTAGTTGCATTTTCCTTGG + Intronic
909638768 1:77848532-77848554 TCATTTTGTTGGATCTTTCTTGG - Intronic
909990924 1:82221874-82221896 CCTTTTTATTGCAGCTTCCAGGG - Intergenic
910279844 1:85487317-85487339 CCCTTTTCTTGGATCTGCGTTGG - Intronic
911674602 1:100645535-100645557 CCCTTTTCTTTAATCTCCCTTGG - Intergenic
912374524 1:109199488-109199510 CCACTTTGATGCAGCTTCCTCGG - Intronic
915739308 1:158106323-158106345 CCCTCTTATTTCATCTCCCTGGG - Intergenic
919445226 1:197696182-197696204 CCCTTCAGCTGCATCTTCATAGG - Intronic
921098832 1:211911019-211911041 CCCTGTTTTTGGTTCTTCCTGGG - Intergenic
921158757 1:212458231-212458253 CCCCTTTGCTGCCTCGTCCTTGG + Intergenic
921603516 1:217132708-217132730 CTCTCTTGTTGCTTCTTCTTGGG + Intronic
922997705 1:229978898-229978920 CCATTTAGTTACATCTTCTTGGG - Intergenic
923330647 1:232920849-232920871 CCCATTTGTGGCAGCTGCCTTGG - Intergenic
924484341 1:244466140-244466162 CACTTTTATTGTATCATCCTTGG + Intronic
1066248380 10:33607515-33607537 CACTTTTGATGCATTTTCTTAGG + Intergenic
1066618604 10:37321425-37321447 CCCTTCTGATGAATCTACCTTGG - Intronic
1067528107 10:47050427-47050449 CCCTTTCCTTGCATTTCCCTGGG - Intergenic
1069591135 10:69642660-69642682 CCCATTTCTTGGGTCTTCCTTGG + Intergenic
1071893844 10:90042249-90042271 CCCATGTGTTGCATTTTCCAAGG - Intergenic
1074119210 10:110480928-110480950 GCCTGTAGTTGCATCTACCTGGG + Intergenic
1074909304 10:117893078-117893100 CCTTTTTGTGGCATCATCCTGGG - Intergenic
1076589221 10:131571748-131571770 TCCTTGTGTGGCACCTTCCTGGG - Intergenic
1076715396 10:132361435-132361457 TCATCTTGTTGCATTTTCCTAGG + Exonic
1078805822 11:14702013-14702035 CCCTTTTTTTGATTCTTTCTGGG + Intronic
1079119858 11:17674095-17674117 CCCTTATATTTCTTCTTCCTTGG + Intergenic
1079312221 11:19377198-19377220 CCCTATTCTTGCTGCTTCCTTGG - Intronic
1079485611 11:20933219-20933241 CCCTTCCTTTGCATCTTCCCAGG - Intronic
1081423805 11:42903091-42903113 TTCCTTTGTTGAATCTTCCTTGG - Intergenic
1081986374 11:47307334-47307356 ACCTTTTCTGGCATCTTTCTGGG + Intronic
1083087349 11:60163849-60163871 TCCTTGTGTTGCATCTAGCTGGG - Intergenic
1084504128 11:69554466-69554488 CCTTTTTATTGCATCTTCTCGGG - Intergenic
1085220469 11:74870005-74870027 CCCTTCTGATGAATCTACCTTGG - Intronic
1085739611 11:79067639-79067661 CCCTTACCTTGCATTTTCCTAGG - Intronic
1087641499 11:100759869-100759891 CCCTCTTATTGTGTCTTCCTGGG - Intronic
1087722800 11:101685877-101685899 CCCTTTTGTTTTTTCTTCCCAGG - Intronic
1088529094 11:110788538-110788560 CCCTTTTCTTGCCACTGCCTTGG + Intergenic
1088904066 11:114140754-114140776 CTCTTTTCTTGTACCTTCCTAGG + Intronic
1089833667 11:121351052-121351074 CCCTTTTGTGGCATTTTTGTAGG - Intergenic
1090451485 11:126810286-126810308 CGCTGTTGCTGCATATTCCTGGG - Intronic
1092044587 12:5421572-5421594 CCGATTTGTTGGATGTTCCTAGG + Intergenic
1092114637 12:5990943-5990965 CCCTTTTGCTGCATCTTTTTTGG - Intronic
1092499063 12:9028051-9028073 CCCTTTTCTTGCCACTGCCTTGG + Intergenic
1092631577 12:10384102-10384124 CCATTTTTTTGCATCCTCTTTGG - Intronic
1096826478 12:54282227-54282249 CCCTTTTCTTGCCACTGCCTCGG - Exonic
1099103934 12:78477745-78477767 TCCTTTTGTTTCATCTTCTCTGG - Intergenic
1101904055 12:108812322-108812344 CCCTTTCCTTGCCTCCTCCTGGG - Intronic
1103531811 12:121607646-121607668 CCCTGTTGCTGTATCTTCCATGG - Intergenic
1104217093 12:126744599-126744621 CCTTTATGTTGCATCTACTTGGG - Intergenic
1105498174 13:20948827-20948849 CCCTTTTCTTGCCACTGCCTCGG + Intergenic
1105939284 13:25132782-25132804 CCCTTTGGTTCCATTTTCCCAGG + Intergenic
1107601643 13:42020285-42020307 TCCTTTTGTCCCATCCTCCTGGG - Intergenic
1107998333 13:45883753-45883775 GACTTTTGTGGAATCTTCCTGGG - Intergenic
1108015125 13:46066609-46066631 CCCTTGTGATGCACCTGCCTCGG - Intronic
1108296183 13:49019852-49019874 CCCTTTTGTTTCTTATTCTTTGG + Intronic
1108667016 13:52642909-52642931 CCCTTTTCTTGCCACTGCCTCGG - Exonic
1109629756 13:65031578-65031600 CCCTTTTATTCCCTTTTCCTAGG - Intergenic
1109868682 13:68302133-68302155 CCCTTTTCTTGCCACTACCTCGG + Intergenic
1110762081 13:79241822-79241844 AACTGTTGTTCCATCTTCCTGGG + Intergenic
1111080664 13:83302452-83302474 ACCTCTTGTTACATCTTCATGGG - Intergenic
1111490259 13:88963010-88963032 CCTTCTTGTTGCATCTTCATAGG + Intergenic
1112009999 13:95285814-95285836 ACCTTTGGTGGCATCTTCTTTGG - Intronic
1112640547 13:101269164-101269186 CACTTTTCTTTCATGTTCCTTGG + Intronic
1113603320 13:111586654-111586676 CCCATTTGCTGGAGCTTCCTGGG - Intergenic
1115470818 14:33766784-33766806 CTCTCCTGTTGCATCCTCCTTGG + Intronic
1118084603 14:62400104-62400126 CCTTTGTGTTGCATCTTCATAGG - Intergenic
1118742338 14:68748676-68748698 CCCTTCTGCAGCTTCTTCCTTGG - Intergenic
1118950270 14:70430182-70430204 GCCTTTTGTTGCAATTTCTTTGG + Intergenic
1119503566 14:75152090-75152112 CCCCTTGGTTGCATCCTCTTTGG + Exonic
1119544373 14:75460963-75460985 CCTTCTTGCTGCATCATCCTAGG + Intronic
1124817670 15:33012531-33012553 CCCTTTTCTTGCCACTGCCTCGG - Intronic
1126303047 15:47221373-47221395 CCCTGTTATTGCAACTCCCTCGG + Intronic
1126543156 15:49843962-49843984 CCCAGTTGATGCAGCTTCCTTGG + Intergenic
1126842152 15:52727749-52727771 CCCTCTTGCTGCCTCTTCCCAGG - Intergenic
1127756951 15:62102093-62102115 TGCTTTTCATGCATCTTCCTTGG + Intergenic
1128434112 15:67628584-67628606 CCCTTTTCTTGCCACTGCCTTGG - Intronic
1129697807 15:77750504-77750526 CCCTGCTGTTGCCTCTTCCTGGG + Intronic
1129829398 15:78658486-78658508 CCCGGTTGTTGCTGCTTCCTAGG - Intronic
1130985689 15:88843122-88843144 CACTTTTGCTGCTTCTTTCTTGG + Intronic
1131408962 15:92189901-92189923 CCCTTTTCTTCCAGCTTCTTAGG + Intergenic
1135888859 16:26338994-26339016 CCCTTTTGTTGTTCCTTGCTGGG - Intergenic
1137834561 16:51578682-51578704 TCCTTTTGTTACAACTTGCTCGG - Intergenic
1140343786 16:74192384-74192406 TCCCTTTGTTAAATCTTCCTTGG - Intergenic
1140459022 16:75123856-75123878 ACCTTGTGATGCATCCTCCTTGG - Intergenic
1141082203 16:81062074-81062096 GCCTTTTTTGGTATCTTCCTCGG + Exonic
1141273317 16:82560465-82560487 CCCTTATGATACAACTTCCTAGG - Intergenic
1141813627 16:86393739-86393761 CCCTTTTCTTCCTCCTTCCTGGG - Intergenic
1142795971 17:2307176-2307198 CCCTTTTCTTGCCACTGCCTTGG - Intronic
1142824095 17:2496852-2496874 CCCTTTTGCTGCATCCTCACAGG - Intronic
1143672470 17:8406009-8406031 CCCTGTTGTTTCACCCTCCTGGG + Intergenic
1143937299 17:10499904-10499926 CCATTTTGTTACCTCTACCTGGG + Intronic
1144662080 17:17077553-17077575 CCCTTTTGTAGCAGTTTCCCAGG + Intronic
1146120097 17:30185401-30185423 TCATTTTGTTGGATCTTTCTTGG - Exonic
1149045807 17:52244079-52244101 CTCTTTTGTTGCACTTGCCTGGG + Intergenic
1153949474 18:10045879-10045901 CCCGTTTGTTCCAGCCTCCTCGG - Intergenic
1154165832 18:12013673-12013695 TCCTTTTGCTGCTTCATCCTGGG + Intronic
1154268467 18:12899035-12899057 CCTTATATTTGCATCTTCCTTGG - Intronic
1155093891 18:22537357-22537379 CCTTTTTCTTTCAGCTTCCTGGG - Intergenic
1155699679 18:28728059-28728081 CCTTTTCCTTTCATCTTCCTAGG - Intergenic
1156003517 18:32412738-32412760 CCCTTTTCTTGCCACTGCCTCGG + Intronic
1156029104 18:32691546-32691568 ACCTATTTTTGCATCTTCTTTGG - Intronic
1156830668 18:41487109-41487131 TCCTTTTGTTCCAGCATCCTTGG + Intergenic
1160086207 18:75779702-75779724 TCCTTTGGTTGCCTCTTCCAGGG - Intergenic
1161348528 19:3779600-3779622 TTCTCGTGTTGCATCTTCCTGGG + Exonic
1162600751 19:11666592-11666614 CCCTTTTCTTGCCACTGCCTCGG + Intergenic
1164222877 19:23212389-23212411 CCCCTTTTTTTCCTCTTCCTTGG + Intergenic
1164611056 19:29631971-29631993 CCCTACTGTTCCATCTTCCCAGG - Intergenic
1166286155 19:41830392-41830414 CCCTTTTCTTGCCACTGCCTCGG - Intergenic
926642933 2:15257012-15257034 CCTTTTTGTTACATCTTTCCTGG + Intronic
926977856 2:18532905-18532927 CCCTTGTATTGCTTCTTCCTTGG + Intergenic
927571307 2:24163113-24163135 CACTTTTCTTGCACCTTGCTAGG - Intronic
928674475 2:33636915-33636937 CCCTTTTCTTGCCACTGCCTCGG - Intergenic
929387164 2:41423203-41423225 TGCTTTTGTTGCATTTGCCTTGG + Intergenic
931710328 2:64984472-64984494 CCCTTTTGTTGCCTGTGCTTTGG + Intergenic
931997889 2:67856521-67856543 CCCTTATGTTCTTTCTTCCTTGG + Intergenic
935363588 2:102267787-102267809 CCCTTTTGCTGGGTCTTCCCTGG + Intergenic
940990305 2:160089217-160089239 CCCTTCTGATGAATCTACCTTGG + Intergenic
943813115 2:192214959-192214981 CTCTGTTGTAGCAGCTTCCTGGG - Intergenic
947848845 2:233267867-233267889 ACCCTTTGAAGCATCTTCCTAGG + Intronic
1168802972 20:655201-655223 TCCTTTTGTGCCATCATCCTTGG + Intronic
1169895072 20:10495969-10495991 CCCTTTTTGTGCATCTTCTCTGG + Intronic
1170847041 20:19971107-19971129 CCTTTCTGAGGCATCTTCCTGGG + Intronic
1173698572 20:45045553-45045575 CAGGTTTATTGCATCTTCCTGGG + Intronic
1174082910 20:47983501-47983523 ACCTTGTGTGGCATCGTCCTGGG - Intergenic
1174794554 20:53511214-53511236 CACTGTAGGTGCATCTTCCTGGG - Intergenic
1175530775 20:59673126-59673148 AGCTTTTGGGGCATCTTCCTGGG + Intronic
1177739808 21:25140582-25140604 CCCTTGTGTGTCATATTCCTGGG + Intergenic
1177914721 21:27074742-27074764 TACTTTTGTTGCATCTTCCTAGG - Intergenic
1178111499 21:29374332-29374354 CCCTTTTTTTTCATCATACTGGG - Intronic
1178388250 21:32174567-32174589 AAGTTTTGTTGTATCTTCCTGGG - Intergenic
1178441706 21:32603717-32603739 CCCTCATGTTCCATTTTCCTTGG - Intronic
949390291 3:3554557-3554579 CCCTTTACTTGCCTCCTCCTAGG - Intergenic
949792155 3:7804638-7804660 CCTATTTGTTCCATCTTGCTAGG - Intergenic
951320577 3:21239420-21239442 CTTTGTTGTTGCATCTTCCTTGG + Intergenic
953437444 3:42889773-42889795 CCCTTTTCTTGCCACTGCCTTGG - Intronic
953794802 3:45976365-45976387 CCCTTTTATTCCATCCGCCTTGG - Intronic
954269901 3:49499712-49499734 TCCTTTGGTTGCATCTTCCTGGG + Intronic
955352040 3:58200817-58200839 CCCTTTTGCTAAATCTGCCTGGG - Intronic
956338703 3:68195279-68195301 GCCTTATGTTGTATTTTCCTGGG - Intronic
959158074 3:102691007-102691029 CTATTTTATTGCTTCTTCCTTGG + Intergenic
961671861 3:128538231-128538253 CCCTTTGGTTGCATCCTCTTTGG - Intergenic
962202373 3:133412546-133412568 CCATCTTCTGGCATCTTCCTTGG - Intronic
962434759 3:135356200-135356222 CCCATTTTTAGCTTCTTCCTGGG + Intergenic
963357663 3:144230303-144230325 CACATTGGTTTCATCTTCCTGGG + Intergenic
966161045 3:176968574-176968596 TCCTGTAGTTGCATCTTGCTAGG - Intergenic
970086631 4:12355104-12355126 CCTTCTTGTTGCATCTTCATAGG - Intergenic
970146583 4:13042421-13042443 CCATTTTGTTTTTTCTTCCTGGG + Intergenic
971813563 4:31459347-31459369 CCCTTTTGGTGAATTGTCCTTGG + Intergenic
972232674 4:37093533-37093555 CCCTTTTGTTGCCACATCATTGG - Intergenic
974940935 4:68466884-68466906 CCATTTTGTTTTATATTCCTTGG - Intronic
974995239 4:69147856-69147878 TTCTTTTGTTGTATTTTCCTAGG + Intronic
975302542 4:72807652-72807674 CCCTTTTCTTGCCACTGCCTTGG - Intergenic
977145089 4:93429672-93429694 TCCTTTTTTTCCATTTTCCTGGG - Intronic
977153379 4:93542630-93542652 CACTTTTTCAGCATCTTCCTTGG - Intronic
979908955 4:126335636-126335658 CTCTTTGGTTGCTTCTTCATAGG - Intergenic
980866951 4:138563028-138563050 CTCAATTGTTGCATCTTCCCTGG - Intergenic
980972519 4:139580434-139580456 CCCTTTGGTGGCATCTTGCCTGG + Intronic
984472361 4:180192840-180192862 CCCTATTTTTGCATCTCCCAGGG - Intergenic
985004873 4:185524188-185524210 CCCTTCTCATGCATCTGCCTGGG + Intronic
985131589 4:186743763-186743785 CCTTTTTAATGCATCTACCTGGG + Intergenic
985164693 4:187080300-187080322 ACCTTTTGTATCATCTACCTCGG + Intergenic
986355271 5:6917946-6917968 CCCTTTTGTTGCATTTGCTTTGG - Intergenic
986413874 5:7508775-7508797 CCCCTTCCTTGCATTTTCCTCGG - Intronic
986594816 5:9410370-9410392 GCATTTTGTTCCATTTTCCTGGG + Intronic
986979737 5:13433542-13433564 CCCTGTTGTCGCAGCTACCTGGG + Intergenic
990993523 5:61708240-61708262 CTTTTTTGTCTCATCTTCCTTGG + Intronic
991128984 5:63099674-63099696 CCCTTTGCTGGCATCATCCTTGG - Intergenic
992596511 5:78352966-78352988 TCCTTTTGTTTCCTCTGCCTGGG - Intergenic
992808210 5:80359601-80359623 CCCTTTTCTTGCCACTGCCTCGG + Intergenic
994219562 5:97180310-97180332 CTCTAGTTTTGCATCTTCCTTGG - Intronic
998799626 5:145856266-145856288 CCCTTTTGTTCCTCCTTCCTAGG - Intergenic
999784138 5:154875870-154875892 CCATTTTGTTCCATTTTCCCTGG - Exonic
1001768320 5:174272751-174272773 CCCTTGTCTTGCAACATCCTGGG + Intergenic
1003379424 6:5609750-5609772 CCCTTTTCTTGCCACTGCCTCGG + Intronic
1003495642 6:6660975-6660997 CCCTTTAGCTCCCTCTTCCTGGG - Intergenic
1004132030 6:12929557-12929579 CCTTGTTGTTGTGTCTTCCTTGG - Intronic
1004259158 6:14093267-14093289 CTCTTTTGTGACACCTTCCTTGG - Intergenic
1004801192 6:19150326-19150348 CCCATTTATTGCACCTTCATAGG - Intergenic
1005108772 6:22254376-22254398 CTCTTTTGTTCTATCTTCTTAGG + Intergenic
1006204181 6:32325633-32325655 CCCTTTTCTTGCAACTGCCTCGG - Intronic
1008317138 6:50058501-50058523 CCCTTTTGTTACTAGTTCCTAGG + Intergenic
1010121542 6:72381164-72381186 CCATTTTGTTGCGTCTTCCTAGG + Intronic
1012025451 6:93984676-93984698 CCATTTTGTTGGATTGTCCTTGG + Intergenic
1013135416 6:107277595-107277617 CCCTTTTGTTGCATCTTCCTTGG - Intronic
1017702555 6:157089529-157089551 CCCTTTGTTTGCACATTCCTGGG + Intronic
1022369345 7:29756298-29756320 ACCTTTTTCTGCATCTTCATAGG - Intergenic
1024750852 7:52463738-52463760 CCCTTTCCTTCCATGTTCCTTGG + Intergenic
1025260129 7:57413099-57413121 CCCTGTTCTTTCATCTTCCCTGG - Intergenic
1025932520 7:66007710-66007732 CGCTTTTTTTGCATCTTCGATGG + Intergenic
1026539007 7:71263994-71264016 GCGTTTTCTGGCATCTTCCTAGG + Intronic
1027964127 7:84983972-84983994 CCCTTTTCTTGCCACTGCCTCGG - Intergenic
1028216474 7:88139651-88139673 CCCTTTCATTTAATCTTCCTTGG - Intronic
1030687288 7:112499829-112499851 CCATTTTGTATCAGCTTCCTAGG + Intergenic
1032007726 7:128317168-128317190 CCTTTTTGCTGCATGTTCCTTGG - Intronic
1032331306 7:130983113-130983135 AGTTTATGTTGCATCTTCCTCGG - Intergenic
1032657616 7:133948555-133948577 CCCCTTTGCTACATTTTCCTGGG - Intronic
1033032066 7:137836898-137836920 CCCATGTGTTTCATCTTCATGGG - Intronic
1034005905 7:147472058-147472080 CCCTTGTTTTGCTTCTTCGTGGG + Intronic
1034040312 7:147870766-147870788 TCCTTATGTTCCATTTTCCTAGG - Intronic
1035115594 7:156520652-156520674 CCTTACTGTTGCATCCTCCTAGG - Intergenic
1037604660 8:20427352-20427374 CCTTCTTGCTGCATCTTCCATGG - Intergenic
1038691695 8:29769988-29770010 GCCTTTTATTGGATATTCCTGGG + Intergenic
1042278735 8:67031767-67031789 CCCTTGTGATCCATCTGCCTCGG - Intronic
1042429950 8:68694200-68694222 CCTATTTGTTTCATTTTCCTAGG - Intronic
1042447653 8:68905690-68905712 GCCTTTTGCTGCATCTTCCAAGG - Intergenic
1042702088 8:71626324-71626346 CTCTCTTGTCTCATCTTCCTGGG + Intergenic
1042770273 8:72372972-72372994 CCCTTTTGTTGAGTCTTGCAGGG - Intergenic
1043050394 8:75377883-75377905 TCCTTTTTTTTCCTCTTCCTGGG + Intergenic
1043154776 8:76764854-76764876 CCCTATTGTTCCAACTTTCTGGG + Intronic
1043589189 8:81808188-81808210 CCCTTTTCTTGCCACTGCCTTGG - Intronic
1043628327 8:82292148-82292170 CCCTTTTCTTGCCACTGCCTCGG + Intergenic
1043713833 8:83455837-83455859 CGCTTGTGTTGCATATTCCCAGG + Intergenic
1044640969 8:94381233-94381255 TCCTTTAGTAGTATCTTCCTTGG - Intronic
1044944725 8:97379667-97379689 GCCCTTTGTTTCATCTTCCAGGG - Intergenic
1045486444 8:102635220-102635242 CCCTTTTGTTGGTTTTTACTGGG - Intergenic
1045586246 8:103540260-103540282 CCCTTTAGTCACAACTTCCTCGG + Intronic
1047007254 8:120633265-120633287 CCCCATTGTTACCTCTTCCTAGG - Intronic
1048202113 8:132383192-132383214 CCCTTATCTTGGATCTTCATTGG - Intronic
1048497219 8:134945362-134945384 CCCGTGGGTTGCTTCTTCCTTGG + Intergenic
1049227063 8:141459494-141459516 CCCTTTTCTTGCCACTGCCTCGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1052911765 9:33889314-33889336 CTGTTTTGTTGCATCTTTATGGG + Intronic
1055922289 9:81473614-81473636 CCCATTTTTTGCAGCTTCTTGGG + Intergenic
1056165311 9:83935410-83935432 CACTTTGGTTTCATCTTACTAGG - Intergenic
1056198453 9:84251319-84251341 CACCTTTGTTGTATCTTACTTGG + Intergenic
1056645835 9:88411024-88411046 CCCTTTTCTTGCCACTGCCTCGG + Intronic
1057115487 9:92517162-92517184 CACTTTTTCTGCATTTTCCTGGG + Intronic
1057732867 9:97625953-97625975 CCTTTTTGTTGGAACTTCTTTGG + Exonic
1058919910 9:109603592-109603614 CCCTAATGTAGCATGTTCCTAGG + Intergenic
1059783293 9:117552648-117552670 TCCCTTTGTCCCATCTTCCTTGG + Intergenic
1060684467 9:125596081-125596103 CCCTTTTCTTGCCACTGCCTCGG - Intronic
1062176144 9:135164184-135164206 CCCTTTTGGAGCATCTGCCGGGG - Intergenic
1062411424 9:136427103-136427125 CGCTTTTATGGCTTCTTCCTAGG - Intergenic
1062552533 9:137096313-137096335 CCTTTTTGTGGCCTCCTCCTGGG - Exonic
1186830795 X:13388200-13388222 CCCTTTGGTTGGATTTTCATTGG + Intergenic
1187444517 X:19349148-19349170 CACTGTGTTTGCATCTTCCTTGG - Intronic
1188232705 X:27684997-27685019 CCCTTTTGGTCAATATTCCTGGG + Intronic
1192594604 X:72393586-72393608 CCCTTTTGTGACAGCTTCTTTGG + Intronic
1193302905 X:79913309-79913331 TTCTTTTGTTGCTTATTCCTTGG - Intergenic
1193530782 X:82651331-82651353 CCCTTCTGTTGAATCTGCCTTGG + Intergenic
1194409810 X:93543783-93543805 CCCTCTTCTTGCAGCTTCATTGG + Intergenic
1194733627 X:97485646-97485668 AGCTTTTGTTGAATATTCCTTGG + Intronic
1195845414 X:109222437-109222459 TCCTTTTGGTGAATTTTCCTGGG - Intergenic
1196763387 X:119221195-119221217 CCCTTTTCTTGCCACTGCCTTGG - Intergenic
1197053380 X:122088304-122088326 CACTTTTCCTGCATCTTCCAAGG + Intergenic
1198082992 X:133256641-133256663 CCCTTTTGATGCATTTACATAGG - Intergenic
1200961317 Y:8998609-8998631 CACTTTCCTTCCATCTTCCTGGG + Intergenic
1202624342 Y:56842184-56842206 CTCTTGTGTTGGATCTGCCTAGG + Intergenic