ID: 1013137260

View in Genome Browser
Species Human (GRCh38)
Location 6:107294566-107294588
Sequence CCATAGACAATAGGTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013137257_1013137260 -9 Left 1013137257 6:107294552-107294574 CCTGCATGTTTAAACCATAGACA 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1013137260 6:107294566-107294588 CCATAGACAATAGGTGCCATTGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013137260 Original CRISPR CCATAGACAATAGGTGCCAT TGG Intronic
907362274 1:53927676-53927698 TCAAAGGCAACAGGTGCCATGGG - Intronic
910346677 1:86246914-86246936 CCATACAAAATAAGTGCCACTGG + Intergenic
910527527 1:88197979-88198001 CCTGAGACAGTGGGTGCCATGGG - Intergenic
916785248 1:168082425-168082447 CCTTAGACACTAGGTGGCAGCGG - Exonic
917601543 1:176579099-176579121 CCACAGACAGAAGGTTCCATAGG + Intronic
917882366 1:179350192-179350214 ACAAATACAATAGGTGCCTTTGG + Intronic
921773055 1:219066251-219066273 CCATAGAGAAAAGGTGCCCTGGG + Intergenic
1063245273 10:4211294-4211316 CCATACAACAGAGGTGCCATTGG + Intergenic
1064329689 10:14381891-14381913 CCATGGCCAATAGATGCTATGGG - Intronic
1065130329 10:22613525-22613547 CCAGAGAAAATAGGAGCCAGTGG - Intronic
1065666458 10:28067890-28067912 CCATAGATGATAGGTGCACTTGG - Intronic
1077864526 11:6211476-6211498 CCATGGACAATCAGGGCCATGGG - Exonic
1079605148 11:22355925-22355947 CCAGAGACAATGTGTGCCAAAGG - Intronic
1083238825 11:61370787-61370809 CCATAGACTATAGGATACATAGG + Intergenic
1085815460 11:79732661-79732683 TGATATACAATAGGTGCCGTAGG + Intergenic
1094248745 12:28334477-28334499 CCAAAGACAAAGGATGCCATAGG - Intronic
1096267600 12:50136170-50136192 CCATATAGAATAGTTTCCATTGG + Intronic
1099260696 12:80378020-80378042 CCATAGACTGTACGTGCCAGTGG + Exonic
1101997077 12:109533224-109533246 CCATACCCAATAGGTGCGACTGG - Intronic
1105652116 13:22390338-22390360 TCATAGATAACAGGTGCCATTGG - Intergenic
1108614628 13:52119948-52119970 CTATAGACAATACTTGCCAAGGG + Intronic
1113109745 13:106810316-106810338 GCAAAGACAATAGGGGACATGGG - Intergenic
1113361611 13:109636544-109636566 ATTTAGACAATAGCTGCCATGGG - Intergenic
1113761862 13:112853743-112853765 CTATGGCCAACAGGTGCCATGGG - Intronic
1128185066 15:65637879-65637901 CCAAAGACAGTTGGTGCCACTGG + Intronic
1133782698 16:8952290-8952312 CCATAGCCAGTAAGTGCTATTGG - Intronic
1134978162 16:18587208-18587230 ACATAGACAATAGTTGGGATGGG - Intergenic
1142912901 17:3111117-3111139 CTAGAGACAGTAGGTCCCATTGG - Intergenic
1144862366 17:18313498-18313520 CCATAGGGAATAGGTTCCAGCGG - Intronic
1150108228 17:62478041-62478063 CCAGGGACAAAAGGTGCCCTGGG - Intronic
1156016569 18:32553328-32553350 TCCTAGATAATAGGAGCCATAGG - Intergenic
1157080170 18:44516054-44516076 CAATAGACATTAGGTGACAGAGG - Intergenic
1163745242 19:19042977-19042999 GCATAGAAACCAGGTGCCATTGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
925298981 2:2796461-2796483 CCACAGGCAGCAGGTGCCATGGG - Intergenic
928279785 2:29935594-29935616 CCATAGACAACATGTGCCCAAGG + Intergenic
929460615 2:42100321-42100343 TCATAGAGAATAGACGCCATTGG + Intergenic
929567461 2:42998797-42998819 CCTTAGACAATAGGTTCTGTGGG - Intergenic
931009203 2:57888624-57888646 CCTTAGACAAGAGGCGCCAGTGG + Intergenic
931172764 2:59822093-59822115 CCATAGGCAATGGGTGCCTCAGG + Intergenic
931954280 2:67400735-67400757 CCATAAACAATAGATGGCACTGG + Intronic
940791990 2:158038883-158038905 GAGTAGACAATAGGTTCCATCGG + Intronic
944026002 2:195167986-195168008 CCTTAGACAATAGCTGCCACAGG + Intergenic
946163237 2:217848475-217848497 CCATTGACCATAGGCTCCATGGG + Exonic
946706581 2:222464303-222464325 CCACAGACAATAAGAGACATTGG - Intronic
1170464746 20:16612305-16612327 CCACAGGCAATATGTGACATTGG - Intergenic
1173069435 20:39747445-39747467 CCAAAGCCAATTGTTGCCATTGG - Intergenic
1176517467 21:7796737-7796759 CCATAGCTCATAGGTGCCAGAGG + Intergenic
1178651495 21:34426749-34426771 CCATAGCTCATAGGTGCCAGAGG + Intergenic
952932336 3:38369871-38369893 CCAGAGACAAGAGGGGCCCTTGG - Intronic
953322712 3:41986594-41986616 CCATAGACATCAAGTGCCCTTGG + Intergenic
957693410 3:83600721-83600743 CCATAGTCAATAGGCACAATAGG - Intergenic
958559864 3:95733061-95733083 CAATAGATAATAGGTGTGATTGG + Intergenic
961072698 3:123949850-123949872 CTATAGACAATATGTGCTCTAGG - Intronic
962895741 3:139713142-139713164 CCATATCAAATTGGTGCCATTGG - Intergenic
964893799 3:161569585-161569607 CCAGAGACAATAGCTCCCCTTGG - Intergenic
966788880 3:183646742-183646764 GCACAGACAATATGTCCCATTGG - Intronic
970863604 4:20733933-20733955 CCACAGACAAAAGGTGCCCAGGG - Intronic
974252365 4:59403140-59403162 ACATAGACAATTTGTGTCATGGG - Intergenic
977014714 4:91678233-91678255 CCATAGAAAATACAAGCCATTGG + Intergenic
984030008 4:174592095-174592117 CCATAGTCAATAAGTGGCAAAGG + Intergenic
992526943 5:77620843-77620865 CCTTAAACAATTAGTGCCATGGG - Intergenic
995385811 5:111587536-111587558 GCATTGACAATAGTTGACATTGG + Intergenic
1000164505 5:158634859-158634881 CCAGAGACACTGGGGGCCATGGG + Intergenic
1005849150 6:29806214-29806236 TCATAGACAGTAGGTTACATAGG + Intergenic
1008057824 6:46963480-46963502 ACATAGACAATATGTGCTCTAGG - Intergenic
1010428964 6:75756631-75756653 CAATAAACAATAGCTGCTATTGG - Intronic
1013137260 6:107294566-107294588 CCATAGACAATAGGTGCCATTGG + Intronic
1024767092 7:52672358-52672380 CCATACAGAATAGGTCACATGGG + Intergenic
1029216474 7:98954059-98954081 CCAAAGACAATAGGTACTTTTGG + Intronic
1036955835 8:13187385-13187407 CACTAGACTATAGGTCCCATTGG + Intronic
1048136789 8:131753861-131753883 CCATGGACAACAGGGGACATGGG - Intergenic
1051015790 9:12474526-12474548 ACATATTCAAGAGGTGCCATGGG + Intergenic
1052418407 9:28208004-28208026 GCATGGAAATTAGGTGCCATTGG - Intronic
1061596864 9:131636185-131636207 CCTTAGACTGTAAGTGCCATAGG + Intronic
1186722443 X:12319769-12319791 CCATAGACAATAGAAGCCCTTGG - Intronic
1189110472 X:38285366-38285388 CCAAAGACAATAGGAGGCACTGG - Exonic