ID: 1013146377

View in Genome Browser
Species Human (GRCh38)
Location 6:107398083-107398105
Sequence AAACTACCACCTGTCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013146375_1013146377 0 Left 1013146375 6:107398060-107398082 CCACTCTGTAACTAACCTTTAAG 0: 1
1: 2
2: 9
3: 53
4: 225
Right 1013146377 6:107398083-107398105 AAACTACCACCTGTCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013146377 Original CRISPR AAACTACCACCTGTCAAATT TGG Intronic
No off target data available for this crispr