ID: 1013146483

View in Genome Browser
Species Human (GRCh38)
Location 6:107399230-107399252
Sequence GGTACCTTGTTAGAGGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013146483_1013146490 14 Left 1013146483 6:107399230-107399252 CCCTTAGCCTCTAACAAGGTACC 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1013146490 6:107399267-107399289 TCTACCACACATTTTCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013146483 Original CRISPR GGTACCTTGTTAGAGGCTAA GGG (reversed) Intronic
904036503 1:27561918-27561940 GAGACCTTGTCAGAGGCTGAGGG + Intronic
905414045 1:37793009-37793031 TTTACCTTGTTAGACGCCAAGGG - Intergenic
911991619 1:104705404-104705426 CATACCTTGTAAGAGTCTAAAGG + Intergenic
916287683 1:163128967-163128989 GGTACCTAGTCAGATGCTACTGG - Intronic
917730717 1:177872007-177872029 GGTACCTCGTTTCAGGCTATGGG + Intergenic
1080211506 11:29791821-29791843 GGTAGCTTTTTAAAGGTTAATGG - Intergenic
1093012000 12:14117064-14117086 GGTACCATGTTACAGCCTAGTGG - Intergenic
1098659495 12:73074732-73074754 GGTAGCTTGTTAGTGGGAAAAGG + Intergenic
1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1104054379 12:125218167-125218189 GGTACCTTCTGGGAGGGTAATGG + Intronic
1106389444 13:29320689-29320711 GGGATCTTGTTAAAGGCTTAAGG + Intronic
1106797219 13:33219087-33219109 GGTACTATGTAAGATGCTAAGGG + Intronic
1115953927 14:38755148-38755170 TGTACCATGTTAGAGGCTTTGGG - Intergenic
1128861977 15:71081817-71081839 GGCATCTGGTTAGAGGCTAGTGG + Intergenic
1146914653 17:36670870-36670892 GGTACCTTGTCAGAGGAAAGAGG - Intergenic
1147049447 17:37780793-37780815 ACTCTCTTGTTAGAGGCTAATGG + Intergenic
1157100218 18:44722435-44722457 GGCAGCTTGTTATAAGCTAAGGG + Intronic
1158779725 18:60632820-60632842 GGTACTTTGTTGTAGGCAAAAGG + Intergenic
925124548 2:1444814-1444836 GGTACCCTGTTGGAAGGTAATGG + Intronic
925124644 2:1445412-1445434 GGTACCCTGTTGGAAGGTAATGG + Intronic
925311820 2:2890185-2890207 GGTGCCTTGTTAGAAACTACAGG - Intergenic
926865775 2:17356687-17356709 GGTACTTTGTTAGAGGCCTGGGG + Intergenic
927571151 2:24161491-24161513 GTTATCTTGTTAAAGGTTAAAGG + Exonic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
942509330 2:176679927-176679949 GGTATCATGTTAGAGGGTTATGG + Intergenic
942723094 2:178974747-178974769 GGAACCTTGCTAGATGCTAAGGG + Intronic
943082730 2:183275938-183275960 AGTATCCTGTTAGAGGCTCAGGG + Intergenic
946739212 2:222785337-222785359 GGTACCTTGGTAGTGTCCAAAGG + Intergenic
947468217 2:230373374-230373396 AGTCTCTTGTTAGAGGCTAATGG + Intronic
1175482358 20:59320683-59320705 GGTGCCTTGGGTGAGGCTAAGGG + Intronic
1175692992 20:61079442-61079464 AGTAACTTGTCAAAGGCTAAAGG - Intergenic
955097310 3:55812225-55812247 GGTACCTTGCTAGCTGCTGAAGG - Intronic
988966177 5:36420362-36420384 GGTAGCTTTTTATATGCTAATGG - Intergenic
990137483 5:52664146-52664168 AGCACCTTGTAAGAGGCTATGGG - Intergenic
998030733 5:138865363-138865385 GGACCCTTGATAAAGGCTAAGGG - Intronic
1005045891 6:21642163-21642185 GCTTTTTTGTTAGAGGCTAATGG + Intergenic
1010380786 6:75222583-75222605 TGAACCTTGTTAGTGGATAAGGG - Intergenic
1013146483 6:107399230-107399252 GGTACCTTGTTAGAGGCTAAGGG - Intronic
1019515621 7:1438631-1438653 AGTACCTTGTTACAGACTCATGG - Intronic
1021345346 7:19520674-19520696 GGTAACTGGCTAGAGGCAAAAGG + Intergenic
1026585270 7:71650994-71651016 GGTAAATTGTTAGAAGTTAAAGG + Intronic
1027489635 7:78806934-78806956 GGTTCCTTATTAGAAGATAAGGG + Intronic
1029888899 7:103905785-103905807 GGTAGCTTGTTAGAGGTGACTGG + Intronic
1030741276 7:113112989-113113011 GGTACTATAATAGAGGCTAAGGG - Intergenic
1033153220 7:138934657-138934679 CGTATCTTGTTAGAGGATGAAGG - Intronic
1036989974 8:13581314-13581336 GGTACCTATTTAGAAGCAAATGG - Intergenic
1038066865 8:23972484-23972506 GGTACCATGTCAGAGACCAAAGG + Intergenic
1038439031 8:27558846-27558868 AGTACCTAGTTAGAGGCTGGGGG + Intergenic
1048391376 8:133968946-133968968 GGGACCTGGTGAGAGGCTATTGG - Intergenic
1050635347 9:7606506-7606528 GGTACATTTTTTGAGGCCAATGG - Intergenic
1052623036 9:30938833-30938855 AGTACCTTTCTAGAGGCAAAAGG + Intergenic
1055901346 9:81241945-81241967 GATACCTTGTGAGAGGCTCGGGG - Intergenic
1056243405 9:84670399-84670421 GATTCCTTGTTAGATGCGAATGG - Exonic
1059484028 9:114613204-114613226 AGTACTTTGTGAGAGGCTGATGG + Intronic
1059671087 9:116493248-116493270 GGTACCTTGTTAGGGGCTTATGG + Intronic