ID: 1013152570

View in Genome Browser
Species Human (GRCh38)
Location 6:107460035-107460057
Sequence CTCAGCCCCACGCCCCGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152570_1013152582 27 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152582 6:107460085-107460107 CATAAGGCAGCGTGGTGCGGCGG No data
1013152570_1013152572 -6 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152572 6:107460052-107460074 GCTGAGCCCTCGTGTCCTCAGGG No data
1013152570_1013152571 -7 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152571 6:107460051-107460073 GGCTGAGCCCTCGTGTCCTCAGG No data
1013152570_1013152576 11 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152576 6:107460069-107460091 TCAGGGCCCAACCAGACATAAGG No data
1013152570_1013152581 24 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152570_1013152579 19 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152579 6:107460077-107460099 CAACCAGACATAAGGCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152570 Original CRISPR CTCAGCCCCACGCCCCGACT AGG (reversed) Intergenic
No off target data available for this crispr