ID: 1013152571

View in Genome Browser
Species Human (GRCh38)
Location 6:107460051-107460073
Sequence GGCTGAGCCCTCGTGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152563_1013152571 14 Left 1013152563 6:107460014-107460036 CCACGTCTCAGTGGTGGAACGCC No data
Right 1013152571 6:107460051-107460073 GGCTGAGCCCTCGTGTCCTCAGG No data
1013152570_1013152571 -7 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152571 6:107460051-107460073 GGCTGAGCCCTCGTGTCCTCAGG No data
1013152559_1013152571 30 Left 1013152559 6:107459998-107460020 CCTCCTGGAGCTGGGGCCACGTC No data
Right 1013152571 6:107460051-107460073 GGCTGAGCCCTCGTGTCCTCAGG No data
1013152560_1013152571 27 Left 1013152560 6:107460001-107460023 CCTGGAGCTGGGGCCACGTCTCA No data
Right 1013152571 6:107460051-107460073 GGCTGAGCCCTCGTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152571 Original CRISPR GGCTGAGCCCTCGTGTCCTC AGG Intergenic
No off target data available for this crispr