ID: 1013152572

View in Genome Browser
Species Human (GRCh38)
Location 6:107460052-107460074
Sequence GCTGAGCCCTCGTGTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152570_1013152572 -6 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152572 6:107460052-107460074 GCTGAGCCCTCGTGTCCTCAGGG No data
1013152560_1013152572 28 Left 1013152560 6:107460001-107460023 CCTGGAGCTGGGGCCACGTCTCA No data
Right 1013152572 6:107460052-107460074 GCTGAGCCCTCGTGTCCTCAGGG No data
1013152563_1013152572 15 Left 1013152563 6:107460014-107460036 CCACGTCTCAGTGGTGGAACGCC No data
Right 1013152572 6:107460052-107460074 GCTGAGCCCTCGTGTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152572 Original CRISPR GCTGAGCCCTCGTGTCCTCA GGG Intergenic
No off target data available for this crispr