ID: 1013152574

View in Genome Browser
Species Human (GRCh38)
Location 6:107460059-107460081
Sequence GGTTGGGCCCTGAGGACACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152574_1013152587 29 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152587 6:107460111-107460133 GGGGTCCCAAGGAAAGTCCTCGG No data
1013152574_1013152586 18 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152586 6:107460100-107460122 TGCGGCGGAAAGGGGTCCCAAGG No data
1013152574_1013152579 -5 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152579 6:107460077-107460099 CAACCAGACATAAGGCAGCGTGG No data
1013152574_1013152581 0 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152574_1013152585 10 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152585 6:107460092-107460114 CAGCGTGGTGCGGCGGAAAGGGG No data
1013152574_1013152584 9 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152584 6:107460091-107460113 GCAGCGTGGTGCGGCGGAAAGGG No data
1013152574_1013152583 8 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152583 6:107460090-107460112 GGCAGCGTGGTGCGGCGGAAAGG No data
1013152574_1013152582 3 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152582 6:107460085-107460107 CATAAGGCAGCGTGGTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152574 Original CRISPR GGTTGGGCCCTGAGGACACG AGG (reversed) Intergenic
No off target data available for this crispr