ID: 1013152575

View in Genome Browser
Species Human (GRCh38)
Location 6:107460067-107460089
Sequence TTATGTCTGGTTGGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152575_1013152582 -5 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152582 6:107460085-107460107 CATAAGGCAGCGTGGTGCGGCGG No data
1013152575_1013152583 0 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152583 6:107460090-107460112 GGCAGCGTGGTGCGGCGGAAAGG No data
1013152575_1013152585 2 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152585 6:107460092-107460114 CAGCGTGGTGCGGCGGAAAGGGG No data
1013152575_1013152581 -8 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152575_1013152586 10 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152586 6:107460100-107460122 TGCGGCGGAAAGGGGTCCCAAGG No data
1013152575_1013152584 1 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152584 6:107460091-107460113 GCAGCGTGGTGCGGCGGAAAGGG No data
1013152575_1013152587 21 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152587 6:107460111-107460133 GGGGTCCCAAGGAAAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152575 Original CRISPR TTATGTCTGGTTGGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr