ID: 1013152576

View in Genome Browser
Species Human (GRCh38)
Location 6:107460069-107460091
Sequence TCAGGGCCCAACCAGACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152570_1013152576 11 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152576 6:107460069-107460091 TCAGGGCCCAACCAGACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152576 Original CRISPR TCAGGGCCCAACCAGACATA AGG Intergenic
No off target data available for this crispr