ID: 1013152581

View in Genome Browser
Species Human (GRCh38)
Location 6:107460082-107460104
Sequence AGACATAAGGCAGCGTGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152575_1013152581 -8 Left 1013152575 6:107460067-107460089 CCTCAGGGCCCAACCAGACATAA No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152573_1013152581 1 Left 1013152573 6:107460058-107460080 CCCTCGTGTCCTCAGGGCCCAAC No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152570_1013152581 24 Left 1013152570 6:107460035-107460057 CCTAGTCGGGGCGTGGGGCTGAG No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data
1013152574_1013152581 0 Left 1013152574 6:107460059-107460081 CCTCGTGTCCTCAGGGCCCAACC No data
Right 1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152581 Original CRISPR AGACATAAGGCAGCGTGGTG CGG Intergenic
No off target data available for this crispr