ID: 1013152957

View in Genome Browser
Species Human (GRCh38)
Location 6:107464205-107464227
Sequence TGGAGCCTTCTCAGGGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013152957_1013152962 9 Left 1013152957 6:107464205-107464227 CCACATACCCTGAGAAGGCTCCA No data
Right 1013152962 6:107464237-107464259 TCCAGAAGCACAGAATGACCAGG No data
1013152957_1013152965 16 Left 1013152957 6:107464205-107464227 CCACATACCCTGAGAAGGCTCCA No data
Right 1013152965 6:107464244-107464266 GCACAGAATGACCAGGTGCTGGG No data
1013152957_1013152964 15 Left 1013152957 6:107464205-107464227 CCACATACCCTGAGAAGGCTCCA No data
Right 1013152964 6:107464243-107464265 AGCACAGAATGACCAGGTGCTGG No data
1013152957_1013152966 19 Left 1013152957 6:107464205-107464227 CCACATACCCTGAGAAGGCTCCA No data
Right 1013152966 6:107464247-107464269 CAGAATGACCAGGTGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013152957 Original CRISPR TGGAGCCTTCTCAGGGTATG TGG (reversed) Intergenic
No off target data available for this crispr