ID: 1013153320

View in Genome Browser
Species Human (GRCh38)
Location 6:107468144-107468166
Sequence CTCTAACTACAGTTGTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013153320_1013153327 30 Left 1013153320 6:107468144-107468166 CCTTAGAACAACTGTAGTTAGAG No data
Right 1013153327 6:107468197-107468219 TTCTAGTTTCTCTCCCTACAGGG No data
1013153320_1013153326 29 Left 1013153320 6:107468144-107468166 CCTTAGAACAACTGTAGTTAGAG No data
Right 1013153326 6:107468196-107468218 TTTCTAGTTTCTCTCCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013153320 Original CRISPR CTCTAACTACAGTTGTTCTA AGG (reversed) Intergenic
No off target data available for this crispr