ID: 1013155370

View in Genome Browser
Species Human (GRCh38)
Location 6:107488377-107488399
Sequence GCCTAGATCCTGGGCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155370_1013155384 25 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155370_1013155380 19 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155380 6:107488419-107488441 CAGCTTCCCCTCGCCTCCCCGGG No data
1013155370_1013155377 -6 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155377 6:107488394-107488416 CTAGGCAGCCACGGGGAGCAGGG No data
1013155370_1013155379 18 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155379 6:107488418-107488440 GCAGCTTCCCCTCGCCTCCCCGG No data
1013155370_1013155381 23 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155381 6:107488423-107488445 TTCCCCTCGCCTCCCCGGGACGG No data
1013155370_1013155382 24 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG No data
1013155370_1013155376 -7 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155376 6:107488393-107488415 TCTAGGCAGCCACGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155370 Original CRISPR GCCTAGATCCTGGGCAAGCC AGG (reversed) Intergenic
No off target data available for this crispr