ID: 1013155374

View in Genome Browser
Species Human (GRCh38)
Location 6:107488387-107488409
Sequence CCCCGTGGCTGCCTAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155374_1013155380 9 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155380 6:107488419-107488441 CAGCTTCCCCTCGCCTCCCCGGG No data
1013155374_1013155382 14 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG No data
1013155374_1013155381 13 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155381 6:107488423-107488445 TTCCCCTCGCCTCCCCGGGACGG No data
1013155374_1013155384 15 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155374_1013155379 8 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155379 6:107488418-107488440 GCAGCTTCCCCTCGCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155374 Original CRISPR CCCCGTGGCTGCCTAGATCC TGG (reversed) Intergenic
No off target data available for this crispr