ID: 1013155375

View in Genome Browser
Species Human (GRCh38)
Location 6:107488387-107488409
Sequence CCAGGATCTAGGCAGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155368_1013155375 -10 Left 1013155368 6:107488374-107488396 CCTCCTGGCTTGCCCAGGATCTA No data
Right 1013155375 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
1013155363_1013155375 21 Left 1013155363 6:107488343-107488365 CCTTGCAGGCGCAAAGCCTGGCT No data
Right 1013155375 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
1013155365_1013155375 5 Left 1013155365 6:107488359-107488381 CCTGGCTCGCTCTGGCCTCCTGG No data
Right 1013155375 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
1013155362_1013155375 22 Left 1013155362 6:107488342-107488364 CCCTTGCAGGCGCAAAGCCTGGC No data
Right 1013155375 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
1013155360_1013155375 23 Left 1013155360 6:107488341-107488363 CCCCTTGCAGGCGCAAAGCCTGG No data
Right 1013155375 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155375 Original CRISPR CCAGGATCTAGGCAGCCACG GGG Intergenic
No off target data available for this crispr