ID: 1013155378

View in Genome Browser
Species Human (GRCh38)
Location 6:107488402-107488424
Sequence AAGCTGCACCCTGCTCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155378_1013155381 -2 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155381 6:107488423-107488445 TTCCCCTCGCCTCCCCGGGACGG No data
1013155378_1013155392 19 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155392 6:107488444-107488466 GGGGAAGAGAAGAAATCAGGAGG No data
1013155378_1013155382 -1 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG No data
1013155378_1013155394 23 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155394 6:107488448-107488470 AAGAGAAGAAATCAGGAGGGAGG No data
1013155378_1013155391 16 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155391 6:107488441-107488463 GACGGGGAAGAGAAGAAATCAGG No data
1013155378_1013155379 -7 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155379 6:107488418-107488440 GCAGCTTCCCCTCGCCTCCCCGG No data
1013155378_1013155380 -6 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155380 6:107488419-107488441 CAGCTTCCCCTCGCCTCCCCGGG No data
1013155378_1013155393 20 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155393 6:107488445-107488467 GGGAAGAGAAGAAATCAGGAGGG No data
1013155378_1013155384 0 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155378_1013155395 26 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155378 Original CRISPR AAGCTGCACCCTGCTCCCCG TGG (reversed) Intergenic
No off target data available for this crispr