ID: 1013155384

View in Genome Browser
Species Human (GRCh38)
Location 6:107488425-107488447
Sequence CCCCTCGCCTCCCCGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155374_1013155384 15 Left 1013155374 6:107488387-107488409 CCAGGATCTAGGCAGCCACGGGG No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155372_1013155384 16 Left 1013155372 6:107488386-107488408 CCCAGGATCTAGGCAGCCACGGG No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155378_1013155384 0 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155370_1013155384 25 Left 1013155370 6:107488377-107488399 CCTGGCTTGCCCAGGATCTAGGC No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
1013155368_1013155384 28 Left 1013155368 6:107488374-107488396 CCTCCTGGCTTGCCCAGGATCTA No data
Right 1013155384 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155384 Original CRISPR CCCCTCGCCTCCCCGGGACG GGG Intergenic
No off target data available for this crispr