ID: 1013155391

View in Genome Browser
Species Human (GRCh38)
Location 6:107488441-107488463
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155385_1013155391 -8 Left 1013155385 6:107488426-107488448 CCCTCGCCTCCCCGGGACGGGGA No data
Right 1013155391 6:107488441-107488463 GACGGGGAAGAGAAGAAATCAGG No data
1013155386_1013155391 -9 Left 1013155386 6:107488427-107488449 CCTCGCCTCCCCGGGACGGGGAA No data
Right 1013155391 6:107488441-107488463 GACGGGGAAGAGAAGAAATCAGG No data
1013155383_1013155391 -7 Left 1013155383 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
Right 1013155391 6:107488441-107488463 GACGGGGAAGAGAAGAAATCAGG No data
1013155378_1013155391 16 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155391 6:107488441-107488463 GACGGGGAAGAGAAGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155391 Original CRISPR GACGGGGAAGAGAAGAAATC AGG Intergenic
No off target data available for this crispr