ID: 1013155395

View in Genome Browser
Species Human (GRCh38)
Location 6:107488451-107488473
Sequence AGAAGAAATCAGGAGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013155385_1013155395 2 Left 1013155385 6:107488426-107488448 CCCTCGCCTCCCCGGGACGGGGA No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155378_1013155395 26 Left 1013155378 6:107488402-107488424 CCACGGGGAGCAGGGTGCAGCTT No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155389_1013155395 -8 Left 1013155389 6:107488436-107488458 CCCGGGACGGGGAAGAGAAGAAA No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155386_1013155395 1 Left 1013155386 6:107488427-107488449 CCTCGCCTCCCCGGGACGGGGAA No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155390_1013155395 -9 Left 1013155390 6:107488437-107488459 CCGGGACGGGGAAGAGAAGAAAT No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155383_1013155395 3 Left 1013155383 6:107488425-107488447 CCCCTCGCCTCCCCGGGACGGGG No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155387_1013155395 -4 Left 1013155387 6:107488432-107488454 CCTCCCCGGGACGGGGAAGAGAA No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data
1013155388_1013155395 -7 Left 1013155388 6:107488435-107488457 CCCCGGGACGGGGAAGAGAAGAA No data
Right 1013155395 6:107488451-107488473 AGAAGAAATCAGGAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013155395 Original CRISPR AGAAGAAATCAGGAGGGAGG AGG Intergenic
No off target data available for this crispr