ID: 1013159254

View in Genome Browser
Species Human (GRCh38)
Location 6:107525527-107525549
Sequence CACCTTCCCCAAGAATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013159254 Original CRISPR CACCTTCCCCAAGAATGCTG TGG Intronic
900561983 1:3311756-3311778 CTCCTTCCCCAAGGAAGCTTGGG + Intronic
901405319 1:9041268-9041290 CACCTTCCCCAAGACAGCCTGGG - Intronic
901808794 1:11754118-11754140 CACCTTCCACCATAATGGTGAGG - Intronic
903373172 1:22850043-22850065 CACCTGCCCCAAGAAAGCCATGG - Intronic
904348750 1:29891272-29891294 CACCTCCCACAAGAATGATCAGG - Intergenic
905183459 1:36180024-36180046 AGCCTTCCTCAAGAAAGCTGTGG + Exonic
906330938 1:44883648-44883670 CAGCCTCCCCCAGAATTCTGAGG - Intronic
908044703 1:60156051-60156073 TACCTTCCCCCAGAATGCTGAGG + Intergenic
908398347 1:63746755-63746777 GACCTTCCAGAAGAGTGCTGAGG + Intergenic
909742393 1:79046015-79046037 CACCTCCCCCTAAAAAGCTGTGG - Intergenic
909935527 1:81546119-81546141 CACCTGCCCCTAGAATTGTGGGG + Intronic
910225949 1:84936265-84936287 CACCTTCCAGAATAATGATGAGG + Intronic
910289925 1:85589611-85589633 CCCCAACCCCAAGAATGCTGTGG - Intergenic
911518462 1:98898720-98898742 CACCTTTCCCAAGAAAACTTTGG - Intronic
912017375 1:105059059-105059081 CCCCTTACCCCAGAAGGCTGAGG - Intergenic
912933693 1:113985086-113985108 CCCCTTCCCCAAGGCTCCTGGGG + Intergenic
915172085 1:153985437-153985459 CACCTCCCCCAAGCCTGCTGGGG + Intronic
924107871 1:240667446-240667468 CACCCTACACAAGAATGCAGAGG - Intergenic
924816690 1:247448167-247448189 CACCTTCTTCAAGAATGCCTGGG - Intronic
1063968232 10:11363274-11363296 CAGCTTCCCCAGGGCTGCTGCGG - Intergenic
1067110079 10:43394189-43394211 CACCTTCCTCAAGAAGGCAGTGG + Intronic
1067721187 10:48728806-48728828 TGCCTTCCACAAGAATTCTGGGG - Intronic
1069727613 10:70591270-70591292 CCCCTGCCCCAGGAGTGCTGTGG + Intergenic
1069761061 10:70811823-70811845 CAACTACCCTAAGACTGCTGTGG - Intergenic
1070279378 10:75037689-75037711 CAACTTCCCCATGTGTGCTGGGG - Intergenic
1070571242 10:77640397-77640419 CACCCTCTCCAAAGATGCTGAGG - Intergenic
1070743362 10:78917187-78917209 CTCCTTCACCAAGAGAGCTGGGG - Intergenic
1070812327 10:79304725-79304747 CTCCCTCCCAAAGAATGCTGTGG + Intronic
1071167331 10:82822206-82822228 CACCTGCCCAAAGAATAATGTGG + Intronic
1071651637 10:87398071-87398093 CACCTGCCCGAAGAAGCCTGTGG + Intergenic
1073006652 10:100330091-100330113 CTCATTCCCCATGAATGCTGTGG - Exonic
1075067325 10:119298062-119298084 GCACTTCCCCCAGAATGCTGAGG - Intronic
1075279301 10:121126124-121126146 CACCACCACCAAGAAGGCTGTGG - Intergenic
1076103962 10:127805369-127805391 CACCTTCCCTAAGACTAATGGGG + Intergenic
1077879118 11:6334144-6334166 CCCCTTCCCCAAGGTTGTTGTGG - Intergenic
1077900975 11:6488484-6488506 CGCCTTCCCCCACAATGGTGAGG - Intronic
1078191808 11:9097354-9097376 CACCTTCCCCAGGTAGGCTTAGG - Intronic
1079340899 11:19611061-19611083 CACCTTCCACCATGATGCTGAGG - Intronic
1080451814 11:32384310-32384332 CCCCTTCCCAAAGAAAGCTCTGG - Intergenic
1081070125 11:38601632-38601654 CACCTTCCCCAGGTAGGCTTAGG - Intergenic
1081723385 11:45306450-45306472 CACTTTCCCCCAGGATCCTGGGG - Intergenic
1081750606 11:45508202-45508224 CACCTACCCCAGGCTTGCTGAGG + Intergenic
1082064531 11:47888871-47888893 TACCTTCCCCAAGGATCATGTGG - Intergenic
1083128209 11:60595053-60595075 CAACACACCCAAGAATGCTGGGG - Intergenic
1085347803 11:75779505-75779527 TACCTTCCCAGAGAGTGCTGTGG + Intronic
1090665616 11:128913218-128913240 AACCTTCTGCAAGAATGCTGAGG - Intronic
1097602299 12:61708172-61708194 CATCTTCCCCAGGAATTCAGAGG + Intergenic
1099366531 12:81772102-81772124 AGCCTTCCCCATGAATGGTGTGG - Intergenic
1101252757 12:102951580-102951602 CACCTTCCAGAAGAACCCTGGGG + Intronic
1101637243 12:106554586-106554608 GATCTTCCCCTAGAATCCTGAGG - Intronic
1101946443 12:109140743-109140765 CATCTTCCCCAACTAGGCTGAGG - Intronic
1103471767 12:121187625-121187647 CACCTTCCCCACTGATGCTCTGG + Exonic
1105841425 13:24256868-24256890 CACCATCCCCAACAATGCAGTGG - Intronic
1106826774 13:33531179-33531201 CACCTTCCACCAGGATGGTGAGG + Intergenic
1107064195 13:36195207-36195229 AGCCTTCCCCAAGGCTGCTGAGG - Intronic
1107470707 13:40688638-40688660 TATCTTCCCCAAGAATAGTGGGG - Intergenic
1108532139 13:51337422-51337444 CACATTTACCAGGAATGCTGTGG - Intronic
1109685605 13:65815538-65815560 CACCTTCTCCAAGGAAACTGAGG + Intergenic
1110531208 13:76601045-76601067 CATCTTCCCCAAGCATTCTTTGG - Intergenic
1111941350 13:94611591-94611613 CACTTTCCTCAAGAATGCCTGGG + Intronic
1113843051 13:113371293-113371315 CACATGCCCCAGGGATGCTGTGG + Intergenic
1113843502 13:113373328-113373350 CCCCATCTCCAAGAATTCTGGGG - Intergenic
1113884215 13:113649475-113649497 CAACATCCCCAGGAACGCTGAGG - Exonic
1114543431 14:23480980-23481002 CCCTTTCCCCAAGATTCCTGAGG + Intronic
1114643840 14:24242493-24242515 CCCCCTCCCCCAGAATTCTGGGG - Exonic
1116081964 14:40185987-40186009 CTCCTGCCCCCTGAATGCTGAGG - Intergenic
1118610371 14:67534615-67534637 CACCTTCCCATAGACTGCTGAGG + Intronic
1119231942 14:72986969-72986991 CACCTACCCCAAGAAAGCTTGGG + Intronic
1119569939 14:75661301-75661323 CTCCTTCCCCAGGAAGGCTCAGG - Exonic
1121211602 14:92211561-92211583 CACCTTCCACCATAATGGTGAGG - Intergenic
1121611389 14:95283278-95283300 CACCTTCCGCCACGATGCTGAGG + Intronic
1122129808 14:99598493-99598515 CACCTTCCCTACGATGGCTGTGG - Intronic
1124018938 15:25902585-25902607 CTCCATCCCCAAGAATTGTGTGG - Intergenic
1127774313 15:62253529-62253551 CACCTTCCTCCAGCCTGCTGTGG - Intergenic
1127975047 15:63990903-63990925 CACCATCCCCAGGCAGGCTGTGG - Intronic
1130766227 15:86874354-86874376 GACCTGCCCCAAGATTGTTGTGG + Intronic
1132677061 16:1125198-1125220 CAGCTTCCCCAAAAGTGCAGTGG - Intergenic
1133045767 16:3087518-3087540 CTCCTTCCTCAGGAAGGCTGGGG - Intergenic
1135572713 16:23561490-23561512 CACCTGCCCCAAGAACTCTGAGG - Intronic
1135874823 16:26188803-26188825 ATCCTTCCCAAAGATTGCTGTGG - Intergenic
1136576246 16:31127057-31127079 CTCCTTCTCCAAGGCTGCTGTGG - Exonic
1136995434 16:35185735-35185757 AATCTTCCCCAAAGATGCTGGGG + Intergenic
1139353797 16:66354649-66354671 TACCCTCCCCAACATTGCTGAGG - Intergenic
1140297773 16:73725894-73725916 CTCCTTTCCCCATAATGCTGTGG - Intergenic
1140934573 16:79658526-79658548 AACTTTCCCCTTGAATGCTGGGG + Intergenic
1144079377 17:11748527-11748549 CAGCTTCCCCATCACTGCTGGGG - Intronic
1144863288 17:18319061-18319083 CACCTCCCCCAGGAATTCTTTGG - Intronic
1147156763 17:38547952-38547974 CACCCTCCCCAAGGGTGCCGGGG - Intronic
1149611068 17:57957986-57958008 CACCTTCCCCTAGGATGAAGGGG - Intergenic
1150175356 17:63049075-63049097 CAAATTCCCAAAGAATTCTGAGG + Intronic
1151234868 17:72712673-72712695 AACCCTCCCCTAGAAAGCTGCGG + Intronic
1151969986 17:77452702-77452724 CCCATTCCCTAATAATGCTGTGG + Intronic
1152605226 17:81286274-81286296 CACCTTGCCCAAGAAGGTTCCGG + Intronic
1153692632 18:7608755-7608777 CAGCTTCCCGAAGACAGCTGTGG - Intronic
1158239578 18:55361608-55361630 CTCCTTCCCCAGCTATGCTGGGG + Intronic
1159897933 18:74014493-74014515 CCCCTTCACAAAGAATGCTGGGG - Intergenic
1162194180 19:8971627-8971649 CTCCTTCCCCAAGTGTGCTGGGG - Intronic
1164534662 19:29076249-29076271 CACCTTCTTCAAGAGAGCTGAGG + Intergenic
1164862460 19:31573029-31573051 CACCTTTCCCAAGTCTTCTGGGG - Intergenic
1165384174 19:35500791-35500813 CACCTTCCCCACCCATGCCGTGG + Intronic
1165462066 19:35949808-35949830 TAACTTCCCCCAAAATGCTGTGG + Intergenic
1165862913 19:38918520-38918542 CTCCTCCCCCAGGAAGGCTGTGG - Exonic
1168093829 19:54103121-54103143 CGCCTTCCTCAAGAATGCCTGGG + Exonic
925288620 2:2731581-2731603 CACCTGCCACATGAATGCTCAGG + Intergenic
925326541 2:3026446-3026468 CTCCTTCCAGAAGAAGGCTGAGG - Intergenic
925662022 2:6212789-6212811 CACCTCCCACAAGTTTGCTGCGG - Intergenic
926686744 2:15704092-15704114 CAGCTTCCCCAGGGAGGCTGGGG + Intronic
927192526 2:20526685-20526707 CATTTTCCCCAGGGATGCTGTGG - Intergenic
927993077 2:27461827-27461849 CTGTTTCCCCTAGAATGCTGTGG - Exonic
929475640 2:42244718-42244740 CACCTTAACCAACAATGATGAGG - Intronic
930286449 2:49435390-49435412 CACTTTCCCCGAGAGTGCTCTGG - Intergenic
932345115 2:70990351-70990373 CCCCCTCCCCCAGAATGTTGAGG - Intronic
932416107 2:71574793-71574815 CCTCTTCCCCAAAATTGCTGGGG - Intronic
932948516 2:76265887-76265909 CAAATTTCTCAAGAATGCTGTGG + Intergenic
933187752 2:79297593-79297615 CACCTATTCCAAGACTGCTGAGG + Intronic
934089297 2:88537557-88537579 CACCTTCCCACAGGAGGCTGAGG + Intergenic
934125205 2:88881777-88881799 CACCATCCCCAAAAATGCAGTGG - Intergenic
937215969 2:120313862-120313884 CGCCTTCCCCCAGATTGCAGCGG + Intergenic
938221087 2:129568577-129568599 CTCCTTCCCAGAGACTGCTGAGG - Intergenic
940237752 2:151529176-151529198 AAACTTCCCCAAGCATGGTGGGG - Intronic
942391657 2:175501831-175501853 CCCCAAGCCCAAGAATGCTGTGG + Intergenic
944679278 2:202062222-202062244 CACCTTCTACAAGAATGTTTTGG - Intergenic
944759721 2:202801986-202802008 AAGCTACCACAAGAATGCTGGGG + Intronic
945900887 2:215536305-215536327 CACATTACCCAAAAATACTGGGG + Intergenic
946307763 2:218865844-218865866 CACCTCTCCCAAGAGTGATGAGG + Intronic
948886634 2:240888175-240888197 CAGCAGCCCCAGGAATGCTGAGG - Intronic
1171879019 20:30602993-30603015 TACCTGCCCCAAGGCTGCTGAGG - Intergenic
1172346214 20:34202773-34202795 CATCTTCCCCAAGATTGCCTTGG + Intronic
1172800188 20:37570910-37570932 CACCTCTCCAAAGAATGCTGGGG + Intergenic
1178097712 21:29233798-29233820 CACTCTCCCCAAGAAAGGTGAGG - Intronic
1178857175 21:36259954-36259976 CAGCTTCCCCAAAAACCCTGTGG - Intronic
1182881062 22:33733855-33733877 CACCATCTCCATGAATGCTATGG - Intronic
1183298622 22:37046931-37046953 CACCTGCCGCAAGGGTGCTGTGG + Intergenic
949867483 3:8558313-8558335 CACCTGCCTCAAGAAAGCTGAGG - Intronic
950097220 3:10337324-10337346 CACTTCGCCCAAGCATGCTGGGG + Intronic
954680729 3:52344607-52344629 CACCCTCCCCAAGAAGGAGGAGG + Exonic
956063794 3:65375742-65375764 TACCATCCCCAGGAATGATGCGG + Exonic
957566457 3:81890522-81890544 CACTTCCCACAAAAATGCTGTGG - Intergenic
959652232 3:108762066-108762088 AACATTTTCCAAGAATGCTGAGG - Intergenic
959717858 3:109453090-109453112 CACCATCCCCAAAAATGCAGTGG - Intergenic
959981650 3:112524338-112524360 CACCACCCCCAGGAATGGTGTGG - Intergenic
960002513 3:112748132-112748154 CACCTAAGCCAAGGATGCTGGGG + Intronic
960210814 3:114963492-114963514 CACCTTCCCAAAGAAAGATGTGG - Intronic
960502612 3:118455309-118455331 CACCTTTGCCAGGAATCCTGAGG + Intergenic
961389800 3:126545730-126545752 CACCTTTCCCCATCATGCTGTGG + Intronic
961806841 3:129495679-129495701 TATTTTCCCCAAGAGTGCTGCGG + Intronic
962009923 3:131382430-131382452 CAACTCCACCAAGAAAGCTGGGG - Exonic
965101309 3:164302281-164302303 CACCTTCTCCAAGAAGGTTCTGG - Intergenic
966148805 3:176843275-176843297 CATTTTCAGCAAGAATGCTGTGG - Intergenic
968878148 4:3285159-3285181 CAAATGCCCCAAGAATGCTATGG - Intergenic
969653130 4:8479280-8479302 CACCTTTTCCCAGAATGATGAGG - Intronic
969704633 4:8785042-8785064 CACCCTTCCCACAAATGCTGTGG + Intergenic
970504559 4:16714377-16714399 CACTGTCCCCAAGAAAGCTGTGG - Intronic
977722670 4:100258411-100258433 CACCAGCCCCAAGAACTCTGAGG + Intergenic
982039538 4:151382710-151382732 AAGCTTCCCCAGGAATGCTAGGG - Intergenic
982332066 4:154192136-154192158 CACCTTCCCCAACCAGGCTTAGG - Intergenic
983147922 4:164241274-164241296 CCCCTTCCTCAAGAGTTCTGAGG - Intronic
983171072 4:164537081-164537103 GGCCTTGCCCAAGTATGCTGGGG + Intergenic
985874013 5:2581634-2581656 CACCTTTCCCCAGAATAGTGTGG + Intergenic
986249023 5:6039064-6039086 CACTCTACCCAAGAAGGCTGAGG - Intergenic
987038725 5:14041926-14041948 GAACTTCCCCCACAATGCTGTGG - Intergenic
988103225 5:26708788-26708810 CATCTTCCTCAAGACTGTTGTGG - Intergenic
991949210 5:71931709-71931731 CACCTGCCCCAAGAGAGATGGGG - Intergenic
992487153 5:77208783-77208805 CACCTTGCCCAAGGTCGCTGAGG + Intergenic
993113669 5:83691458-83691480 AACCTTCTCCAAGAATTATGAGG - Intronic
994831016 5:104784248-104784270 CACCTTCCGCCATAATTCTGAGG - Intergenic
998144236 5:139717158-139717180 CACCATCCCCCTGAATGCTGTGG - Intergenic
999430546 5:151521750-151521772 GACCTTCACCACGACTGCTGGGG - Exonic
1000718601 5:164678670-164678692 CAGCTTCCCCTAAAATTCTGAGG + Intergenic
1001060823 5:168487032-168487054 CTCCTTCCCGACGAATGCTGAGG - Intronic
1002586436 5:180251817-180251839 CACCTGCCCCACTCATGCTGCGG - Intronic
1005389681 6:25320662-25320684 CACTTCCACCAAGAATGCTAAGG - Intronic
1007895134 6:45347593-45347615 GACAGACCCCAAGAATGCTGGGG - Intronic
1010811586 6:80306808-80306830 CAACTTCCACAAGGAAGCTGGGG - Intronic
1012020758 6:93915963-93915985 CAACTTCCCCAAAAATCCAGAGG + Intergenic
1013159254 6:107525527-107525549 CACCTTCCCCAAGAATGCTGTGG + Intronic
1015518513 6:134108581-134108603 CACCTTCCCCCAGGATTGTGAGG - Intergenic
1016246218 6:141984217-141984239 CACCTTCCCCAAGGGGTCTGGGG + Intergenic
1018685275 6:166299128-166299150 CCCCCTCTCCATGAATGCTGTGG + Intergenic
1018998033 6:168725017-168725039 CACTTTCCCCCAGAGAGCTGAGG + Intergenic
1022140700 7:27491251-27491273 CACCTTCCCAAAGGCTGCTCTGG - Intergenic
1023983209 7:45081441-45081463 CACCTTCCCCTAAACAGCTGAGG - Intronic
1025095417 7:56092227-56092249 CACCTTTCCCAAGACCCCTGTGG + Intronic
1029493932 7:100887181-100887203 CACCTTCCCCGTGACTGATGCGG - Exonic
1029702593 7:102257215-102257237 CCCCTTCTCCAAGATTGCCGGGG + Exonic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1031766356 7:125782376-125782398 GACCTTCCACAAGTATGCTCAGG + Intergenic
1031883417 7:127221437-127221459 CACCTTGCCCAAGTATGCCCGGG + Intronic
1032425847 7:131821540-131821562 CACCTTCCCCAACTAGGCTTAGG + Intergenic
1033803371 7:144926983-144927005 CACCTTCCCCCACAATTATGAGG - Intergenic
1034715701 7:153239411-153239433 CATCTTCCCCAGGCAGGCTGTGG - Intergenic
1036127532 8:6076639-6076661 AACCTTTCCCAAGAATGCATAGG + Intergenic
1036702476 8:11022260-11022282 CACCTTTCCCAGGGATGCTAAGG - Intronic
1036759254 8:11496007-11496029 CAGTTTTCCCAAGAATGCTCAGG - Intronic
1038040169 8:23717448-23717470 CACCTACCCCAAGCATGCCCAGG - Intergenic
1038157228 8:25001517-25001539 CCTCTTCCCCATGAATGCTTTGG + Intergenic
1039151512 8:34511990-34512012 CACACTCCCCAAGATTCCTGTGG - Intergenic
1039255353 8:35712606-35712628 CACCTTTCCCCAAAATGCAGAGG + Intronic
1042513085 8:69631470-69631492 CACCTGACCCCAGAAGGCTGAGG + Intronic
1043131987 8:76473212-76473234 CCCCTTCCCCAAGAGTCCTTGGG + Intergenic
1046059791 8:109124627-109124649 GAACTTCCTCAAGAATGCCGTGG + Intergenic
1047548883 8:125848238-125848260 CACATTTCCCAAGAATGGAGTGG + Intergenic
1047698656 8:127428877-127428899 CACCTTCCCTAAGGAGCCTGGGG - Intergenic
1049275948 8:141720244-141720266 CAGCTTCACCAGGAATTCTGGGG + Intergenic
1050063332 9:1733298-1733320 CCCCTTCCCCATGACAGCTGTGG - Intergenic
1052600239 9:30617996-30618018 CACCTTCCACAATAATTGTGAGG + Intergenic
1055274045 9:74594062-74594084 CAAATTCCCCAAAAATACTGTGG - Intronic
1055496398 9:76859655-76859677 CTGCTTCCCCAAGAATTCAGAGG + Intronic
1055501650 9:76907351-76907373 CACTTTCCACAGAAATGCTGTGG - Intergenic
1056020531 9:82433633-82433655 CACCTTCTCCATGGCTGCTGTGG + Intergenic
1058127678 9:101214208-101214230 CACATTCTGCAGGAATGCTGGGG + Intronic
1061434304 9:130551321-130551343 CACCGTCTCCAAGAAGGCTTTGG - Intergenic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1062129394 9:134884482-134884504 CACCATCCCAGAGACTGCTGAGG - Intronic
1062325650 9:136011224-136011246 CACCCTCCCCAAGAAGGGGGAGG + Exonic
1062339801 9:136088870-136088892 AACCTTCCCCCAGGATGCCGGGG - Intronic
1062360354 9:136185332-136185354 CAGCTGCCCCCAGAACGCTGGGG - Intergenic
1203782971 EBV:111216-111238 CACCTTCCCCAAAAAGGCCTGGG + Intergenic
1185530069 X:810490-810512 CCCTGTCCCCAAGAATCCTGGGG - Intergenic
1186538326 X:10372899-10372921 CACCTCCTCCAATGATGCTGAGG - Intergenic
1187682152 X:21778400-21778422 CAGCTTCCCCAAGGATGTTATGG + Intergenic
1189487321 X:41443602-41443624 CACCCTAGCCCAGAATGCTGAGG - Intergenic
1190931557 X:54952909-54952931 CAAGTTCCCCAATAATGTTGTGG - Intronic
1191731717 X:64343358-64343380 CATATTCCCAAAGAATTCTGTGG + Intronic
1198332745 X:135636808-135636830 CACCTTCCCCAACAGACCTGTGG + Intergenic
1200736879 Y:6809110-6809132 CACCGTACCTAAGAATGCTTGGG - Intergenic
1201980293 Y:19899902-19899924 CCCCAAGCCCAAGAATGCTGTGG - Intergenic
1202579369 Y:26363038-26363060 CAAGTTCCCCATGGATGCTGAGG - Intergenic