ID: 1013160848

View in Genome Browser
Species Human (GRCh38)
Location 6:107543283-107543305
Sequence GGCAAGCTCCCCAGTGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013160842_1013160848 20 Left 1013160842 6:107543240-107543262 CCATCTCTGTATTCTTCCATGTA 0: 1
1: 0
2: 4
3: 36
4: 452
Right 1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG 0: 1
1: 0
2: 1
3: 17
4: 164
1013160841_1013160848 30 Left 1013160841 6:107543230-107543252 CCGTTTCTTTCCATCTCTGTATT 0: 1
1: 0
2: 7
3: 149
4: 1479
Right 1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG 0: 1
1: 0
2: 1
3: 17
4: 164
1013160844_1013160848 4 Left 1013160844 6:107543256-107543278 CCATGTAGAGTGTTGGCCACATT 0: 1
1: 0
2: 2
3: 13
4: 136
Right 1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG 0: 1
1: 0
2: 1
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013160848 Original CRISPR GGCAAGCTCCCCAGTGGTCA TGG Intronic
901379591 1:8864045-8864067 GCCAAGCTCCCCAGTCATCCTGG + Exonic
901797949 1:11691515-11691537 GGCCAGCTCCCCAGAGGCCTAGG - Exonic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904432356 1:30472645-30472667 GGCACGCTCTCCAGTGGGGAGGG - Intergenic
905975844 1:42173040-42173062 GGGTAGCTGCCCAGTGGGCAAGG + Intergenic
906240893 1:44241584-44241606 TGCAAGATCACCAGGGGTCAGGG + Intronic
909403362 1:75258706-75258728 GTCAAGATACCCAGGGGTCAGGG - Intronic
914900115 1:151707185-151707207 GGCAGGCTGCCCAGTGGGCTGGG + Exonic
915943964 1:160136464-160136486 GGCCAGCTACCCAAGGGTCAGGG + Intronic
918299486 1:183189596-183189618 GGCAATCTCGTCTGTGGTCAAGG - Intronic
920045314 1:203128771-203128793 GGCAAGCACCTGTGTGGTCAGGG - Exonic
920150222 1:203900350-203900372 GCTAAGCTCCTCAGTGCTCAGGG - Intergenic
923723116 1:236484055-236484077 GCCAAGCTCCCCAGTCATCCTGG - Intronic
924792848 1:247269259-247269281 AGCAGGCTCCCCTGTGGTCCAGG + Intergenic
1065967512 10:30781622-30781644 GGCGAGCTTCCCAGTGGCAATGG - Intergenic
1066116323 10:32243476-32243498 GCCAATCTCCCCAGTGATCTGGG + Intergenic
1066486753 10:35852996-35853018 AGCAAAGTCCCCAGTGGACAGGG - Intergenic
1067342907 10:45419046-45419068 GGAAAGCGCCCCTGTGGTCCTGG - Intronic
1067580563 10:47442892-47442914 GGGAAGCTCTCCAGTGGTTTGGG + Intergenic
1071775068 10:88777608-88777630 GGCAAGCTTCCCAGTGTACCTGG - Intronic
1074618713 10:115094259-115094281 GCCTAGCTCCCCGTTGGTCAGGG - Intronic
1076342624 10:129760044-129760066 GCCATGCTCCCCAGAGGACAAGG + Intronic
1077301333 11:1848525-1848547 CCCAAGCTCACCAGTGGCCACGG + Intergenic
1078425157 11:11243772-11243794 GGCTGGGTCCCCACTGGTCAGGG + Intergenic
1081323683 11:41720256-41720278 GGAAAGCTCCCCAGTTGTCAGGG + Intergenic
1084420939 11:69060222-69060244 GGAAAGCTCTGCAGTGGGCAGGG - Intronic
1084499933 11:69529490-69529512 GGCGAGCTGCTCACTGGTCAAGG + Intergenic
1085398297 11:76218908-76218930 GGCCAGCACCCCAGTTGCCAGGG + Intergenic
1085762323 11:79252705-79252727 GTCAAGCTCCCTAGTGGGTAGGG - Intronic
1086511485 11:87562824-87562846 AGGAAGCTCCCCAGAGGCCAAGG - Intergenic
1089623993 11:119739816-119739838 GGCAACCTCCCCACTGAACATGG - Intergenic
1090028021 11:123184320-123184342 GGCAGGATCCCCTGAGGTCAGGG - Intronic
1090789306 11:130076687-130076709 GGCACACTCCCCAGTGGTTGTGG + Intronic
1093019899 12:14193761-14193783 GGCAAGCTGCCAAGAGGCCAGGG - Intergenic
1093986977 12:25545366-25545388 ATTAAGCTCCCCAGAGGTCAAGG - Intronic
1096678083 12:53236422-53236444 TGGAAGCTCTCCAGTGGACAGGG - Intergenic
1096975699 12:55698308-55698330 GGGAAGCCCCTCAGAGGTCAGGG - Intronic
1097079380 12:56418709-56418731 GGCATGCACCCCTGTGGTCCTGG - Intronic
1099936383 12:89130642-89130664 AGCCAGCTCCCCAGAGGACATGG + Intergenic
1101606679 12:106252133-106252155 GGCAAGGCCCCCAGTGGCCAAGG + Intronic
1102565593 12:113795353-113795375 GGCAGGCTTCCCAGTGCTTAGGG - Intergenic
1104044999 12:125155659-125155681 TGCAAGCTCCCCAGCAGCCAGGG - Intergenic
1104763327 12:131311354-131311376 GTCAAGCTCCTCAGTGTTAAGGG + Intergenic
1104816171 12:131646716-131646738 GTCAAGCTCCTCAGTGTTAAGGG - Intergenic
1113015407 13:105823126-105823148 GGCAAGCTCCTGAAAGGTCATGG - Intergenic
1114747691 14:25167784-25167806 GTTAAGCTACTCAGTGGTCAGGG - Intergenic
1118096989 14:62547566-62547588 GGCAAGCTCCCCACTGGTTTGGG - Intergenic
1119793273 14:77373479-77373501 ACTAAGCTCTCCAGTGGTCATGG - Intronic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1129113147 15:73349956-73349978 GGCAAGCTACCAAGAGGCCAAGG - Intronic
1129698597 15:77754714-77754736 GGCAACCTCCTCAGAAGTCAGGG + Intronic
1130553980 15:84910038-84910060 GGGGAGCTCACCAGAGGTCAGGG - Intronic
1134221640 16:12359377-12359399 GGCAACCTCATCTGTGGTCAGGG - Intronic
1136084779 16:27877119-27877141 CTCTTGCTCCCCAGTGGTCAGGG - Intronic
1137850612 16:51738375-51738397 GGCAAGATCCTCAGTGGACAGGG - Intergenic
1138516575 16:57538651-57538673 GTCAACCTCCCCAGTGGTCTCGG + Intergenic
1138562100 16:57807405-57807427 GCCAGGCTCCTCAGTGGGCATGG + Intronic
1141027293 16:80560584-80560606 GACAAGCTCCCAAGTGGTGCTGG - Intergenic
1142325789 16:89413764-89413786 GACAAGCTCCCCAGGGGTGAGGG + Intronic
1142471888 17:169330-169352 GGCAGCCTCCCCAGGGGCCAGGG + Intronic
1142572421 17:883661-883683 GGCAAGGACTTCAGTGGTCACGG + Intronic
1144376839 17:14651205-14651227 AGCAGGCTCTCCAGTGTTCATGG - Intergenic
1144859928 17:18295026-18295048 AGCACCTTCCCCAGTGGTCAGGG - Intronic
1145167754 17:20629072-20629094 GGCAGACTCCCCAATGGTGAGGG + Intergenic
1147878462 17:43638446-43638468 GGCATGTTCCCCAGTGGAGAGGG + Intergenic
1148384810 17:47226712-47226734 GGCATGCTCCACAGTCCTCAGGG + Intergenic
1148463440 17:47850992-47851014 GGCGAGCTCTCCAGCGGTAAGGG + Exonic
1150871102 17:68911492-68911514 GGCAAGCTTCCCACTGGCCCAGG - Intronic
1203164106 17_GL000205v2_random:78286-78308 CACAAGGTCCCCAGTAGTCAGGG + Intergenic
1155082915 18:22428523-22428545 TGGGAGCTCCCTAGTGGTCACGG + Intergenic
1155251907 18:23960833-23960855 GGCAGGCTCTCAAGTGGTCAGGG - Intergenic
1156421670 18:36960513-36960535 GTCAGGCTACACAGTGGTCAGGG - Intronic
1157333539 18:46720911-46720933 GGCAACCTCCCCTGTGGGCAGGG + Intronic
1159944598 18:74434913-74434935 TGGAAGATCCCCAGTGGTGATGG + Exonic
1161454657 19:4363954-4363976 GGCAGGATCCCCAGTGGTGCAGG - Intronic
1162243174 19:9374506-9374528 GGGAAGCCACCCAGTGTTCATGG - Intronic
1164078151 19:21839395-21839417 CACAAGCACCCCAGTGGACAAGG + Intronic
1164281248 19:23770616-23770638 CACAATCTTCCCAGTGGTCAGGG - Intronic
1164311812 19:24052494-24052516 CACAATCTTCCCAGTGGTCAGGG - Intronic
1168461404 19:56561973-56561995 GGAAAGCTCCCCAGTCATCAAGG + Intergenic
926192087 2:10735961-10735983 TGCAAGCTCCCCAGTGATGCTGG + Intronic
926556346 2:14362536-14362558 GCCAGGCTCACCGGTGGTCAGGG + Intergenic
926920096 2:17931700-17931722 GGCAAGCTCCCCGGTGAACCAGG - Exonic
929899763 2:45990553-45990575 TGAGAGCTACCCAGTGGTCAGGG - Intronic
930018900 2:46989097-46989119 GGCAAGCTCCCCAGTCCCCTAGG - Intronic
935666873 2:105519889-105519911 TGCCAGCTCCTCAGAGGTCAAGG - Intergenic
935736789 2:106112417-106112439 GGCAGGGACCCCAGTGGCCATGG + Intronic
936165220 2:110114981-110115003 GGCAGGATCCCCAGGGATCAGGG + Intronic
945726373 2:213475822-213475844 GGCCAGGTCCCCAGTTCTCAGGG - Intronic
946181235 2:217950449-217950471 AGCACGCTCCCCAGTGACCAGGG - Intronic
948486741 2:238286160-238286182 TCCTAGCTCCCCGGTGGTCAGGG + Intronic
1168833255 20:859061-859083 GGCAGGCTCCCCACTGGTGCAGG + Intergenic
1173302819 20:41818872-41818894 GGCACCCTCCCCAGTGATCTTGG + Intergenic
1174770657 20:53297047-53297069 GGCCAGATCACCAGGGGTCATGG - Intronic
1178663149 21:34523265-34523287 TGCAAGCTCCCCAGTGAACAGGG + Intronic
1179411665 21:41167794-41167816 GGAAAGCGCCCCAGCGGCCACGG - Exonic
1182919169 22:34063911-34063933 GGCTGGCTCCCCAGTGGTGGTGG + Intergenic
1183975138 22:41507687-41507709 GGCAACCTCAACAGTGGCCAGGG - Intronic
1184886869 22:47351923-47351945 GGCCAGCTTCCTACTGGTCAGGG + Intergenic
1185213216 22:49583585-49583607 TGCATGCTTCCCATTGGTCATGG + Intronic
1185355708 22:50368649-50368671 GGCAAGCTACCCAGGTGCCAAGG - Intronic
952737069 3:36701528-36701550 TGCAAGCTCCACAGTGATTACGG + Intergenic
953520753 3:43640403-43640425 GGCAAGTTCTCCACTGGCCAGGG - Intronic
953851736 3:46470064-46470086 AGCTTGCTCCCCAGTGGGCAAGG + Intronic
954446473 3:50549598-50549620 GGCATGCCCCTCAGTGGTCAGGG - Intergenic
954631384 3:52049555-52049577 GGCAAGCTTCCAAGGGGACAAGG + Exonic
959449438 3:106480995-106481017 GGCATGCTACCAGGTGGTCATGG + Intergenic
961583634 3:127903772-127903794 AGCCAGGGCCCCAGTGGTCACGG + Intergenic
961636213 3:128334803-128334825 GCCTAGCTCCCCAGAGGGCATGG - Intronic
965099656 3:164279045-164279067 GGCAAGATCCCCCCTGGTCCTGG - Intergenic
967844223 3:194031582-194031604 GGCTGGCTCTCCAGAGGTCAGGG + Intergenic
968442056 4:629113-629135 GCCCAGCTACCCAGTGTTCATGG + Intronic
969606606 4:8205211-8205233 GGTCGGCTCCTCAGTGGTCACGG - Exonic
971474093 4:27056334-27056356 CGCAGGCTCCTCCGTGGTCAGGG + Intergenic
974240140 4:59236191-59236213 GGCAAGCCACCCAGGGGCCAAGG - Intergenic
976487706 4:85627501-85627523 GTTAGGCTCCTCAGTGGTCAGGG + Intronic
978112437 4:104978804-104978826 GGCAGGCTCCCCTGTGGTCCAGG - Intergenic
980037774 4:127904934-127904956 GTCAGGCTACACAGTGGTCAGGG + Intergenic
985894945 5:2743387-2743409 GGCAAGCGCCCCGGTGCTCTCGG + Intergenic
986190157 5:5489305-5489327 GCCAAGCTCCTCTGTGCTCAGGG - Exonic
986481130 5:8189407-8189429 CGCAAGCTCTGCAGTGCTCAGGG + Intergenic
988930082 5:36028828-36028850 GGAAAGCTGCCCAGTGTTGATGG - Intergenic
992597174 5:78359205-78359227 AGCAAGCTCCCCAAAGGCCAAGG + Intergenic
993068913 5:83134025-83134047 GGCAAGCGCCGCAGTCTTCACGG + Intronic
994060934 5:95475908-95475930 GGCATGCTCTTCAGTGGTGATGG + Intronic
998481430 5:142466449-142466471 CCCAAACTCCCCAGTGCTCAAGG - Intergenic
998538287 5:142954586-142954608 GGCAAGATCCCCAGAGGGGAGGG - Intronic
1002372386 5:178765656-178765678 TGCAAGCTCCCCAGCAGCCAGGG + Intergenic
1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG + Intronic
1003564538 6:7211970-7211992 AGCAGACTCCCCAGTGTTCAGGG - Intronic
1004366126 6:15014168-15014190 TTTTAGCTCCCCAGTGGTCAAGG + Intergenic
1004833506 6:19503683-19503705 GGAAAGCTACCCTGTGTTCATGG - Intergenic
1004870466 6:19899107-19899129 TGCCAGCTCCACAGTGATCAGGG + Intergenic
1006382660 6:33709178-33709200 TGTAAGCTCCTCAGTGGTGAAGG + Intronic
1009788458 6:68368462-68368484 GGCATGCTGAACAGTGGTCAGGG + Intergenic
1010810067 6:80290454-80290476 GGCATGCTCCGCAGTGGGCGGGG - Intronic
1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG + Intronic
1016749649 6:147618694-147618716 GGCAAGCTTCACATTGGTCAGGG - Intronic
1017015653 6:150097479-150097501 GGCAGGCTCCCCACTGTTCCAGG - Intergenic
1018004491 6:159608924-159608946 TGCAAGCTCTCTAGTGGCCATGG + Intergenic
1020189856 7:5987183-5987205 GGCCAGCTCCCCAGGGGACAGGG - Exonic
1020293067 7:6737491-6737513 GGCCAGCACCCCAGGGGACAGGG + Intergenic
1022393039 7:29960037-29960059 GGAAATCTGTCCAGTGGTCATGG + Intronic
1023479732 7:40621283-40621305 AGAAAGCTCCCCAGAGTTCAGGG - Intronic
1030931025 7:115523740-115523762 AGCAAGCACCTCAGTGGTCGTGG + Intergenic
1031992632 7:128207952-128207974 GGCAGCCTCCCCTGTGGACAAGG - Intergenic
1034335904 7:150323409-150323431 GGCACGCGGCCCAGGGGTCAGGG + Exonic
1034827746 7:154282042-154282064 GTCAATCTCCCCATTGGACAGGG - Intronic
1036248628 8:7142494-7142516 GGCCGACTCCCCATTGGTCATGG + Intergenic
1039889509 8:41674535-41674557 GGAGAGCTCTTCAGTGGTCATGG - Intronic
1040375091 8:46817298-46817320 CACAATCTCCCCTGTGGTCAGGG - Intergenic
1043393691 8:79815923-79815945 GGCAAGCTCCCTAGTGATGCTGG - Intergenic
1045663950 8:104466587-104466609 GGCAGCCTCCCCAGTCGTCCCGG - Intronic
1049031969 8:140044605-140044627 GGCAAGCTGCCCAGTGGAGGAGG + Intronic
1049058995 8:140261340-140261362 GACAACCTCCCCAGAGGGCAGGG - Intronic
1051124244 9:13786178-13786200 TGCAAGCTCCCCACTGGGAAAGG + Intergenic
1051156751 9:14156616-14156638 GGCAGGGTCCACAGTGGCCATGG + Intronic
1056240799 9:84644781-84644803 AGCAAGCACCTCAGTGGTCATGG + Intergenic
1056800229 9:89685897-89685919 GGCGAGCCTCCCAGTGCTCACGG - Intergenic
1056823423 9:89860374-89860396 CACAAGCTCCCCAGTGGTGAGGG - Intergenic
1059411146 9:114133051-114133073 GGCAGGCTCCCCAGAGGATAAGG - Intergenic
1060084090 9:120680922-120680944 AGCAGGCTCCCCTGTGGCCAAGG + Intronic
1061039531 9:128131909-128131931 CATAAGCTCCCCAGTGGTGAGGG + Intergenic
1061523654 9:131138952-131138974 AGCAATCTCCCTAGTTGTCATGG + Intronic
1061550159 9:131329696-131329718 GGCAAGCTCCTCTGTGATCAGGG + Intergenic
1187419989 X:19125644-19125666 GGACAGCTCACCAGTGCTCAGGG + Intergenic
1189491573 X:41474745-41474767 GGCCAGCCCCCCAGTGGTGTTGG - Exonic
1193356315 X:80523576-80523598 GGAAATCTTCCCAGTGGACAGGG + Intergenic
1194278217 X:91913527-91913549 CCCATGCTCCACAGTGGTCATGG + Intronic
1196295057 X:113987540-113987562 TGCAAGCTCACCAGTGTTCAGGG - Intergenic
1200595554 Y:5135602-5135624 CCCATGCTCCACAGTGGTCATGG + Intronic
1200601888 Y:5215385-5215407 GGCTAGCCCCCCAGAGTTCAGGG - Intronic
1201791834 Y:17849390-17849412 GGCAAGCTCGCCTTTGTTCATGG - Intergenic
1201809720 Y:18056599-18056621 GGCAAGCTCGCCTTTGTTCATGG + Intergenic
1202264721 Y:23006144-23006166 CACAATCTCCCCTGTGGTCAGGG - Intergenic
1202267912 Y:23040281-23040303 CACAATCTCCCCTGTGGTCAGGG - Intergenic
1202353437 Y:24019045-24019067 GGCAAGCTCGCCTTTGTTCATGG - Intergenic
1202417712 Y:24639886-24639908 CACAATCTCCCCTGTGGTCAGGG - Intergenic
1202420904 Y:24674025-24674047 CACAATCTCCCCTGTGGTCAGGG - Intergenic
1202449882 Y:24996057-24996079 CACAATCTCCCCTGTGGTCAGGG + Intergenic
1202453074 Y:25030200-25030222 CACAATCTCCCCTGTGGTCAGGG + Intergenic
1202517342 Y:25651070-25651092 GGCAAGCTCGCCTTTGTTCATGG + Intergenic