ID: 1013164922

View in Genome Browser
Species Human (GRCh38)
Location 6:107581114-107581136
Sequence CAAGGACCTGTTTGATTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013164917_1013164922 23 Left 1013164917 6:107581068-107581090 CCAGGATCTGGACATTTGAAGCT 0: 1
1: 0
2: 0
3: 16
4: 2162
Right 1013164922 6:107581114-107581136 CAAGGACCTGTTTGATTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013164922 Original CRISPR CAAGGACCTGTTTGATTAGT GGG Intronic
No off target data available for this crispr