ID: 1013165682

View in Genome Browser
Species Human (GRCh38)
Location 6:107589800-107589822
Sequence CTATCTATGAAGAGGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013165682_1013165688 28 Left 1013165682 6:107589800-107589822 CCCACCTACCTCTTCATAGATAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1013165688 6:107589851-107589873 ACGTGCACACACACACACACGGG 0: 2
1: 35
2: 185
3: 2138
4: 4363
1013165682_1013165687 27 Left 1013165682 6:107589800-107589822 CCCACCTACCTCTTCATAGATAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1013165687 6:107589850-107589872 CACGTGCACACACACACACACGG No data
1013165682_1013165686 -6 Left 1013165682 6:107589800-107589822 CCCACCTACCTCTTCATAGATAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1013165686 6:107589817-107589839 AGATAGTCATGCACACTTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013165682 Original CRISPR CTATCTATGAAGAGGTAGGT GGG (reversed) Intronic
902813236 1:18901508-18901530 CTAGGTTTGGAGAGGTAGGTGGG - Intronic
906400598 1:45501490-45501512 CTATATATGAAAAGATAGATTGG + Intronic
906426115 1:45714237-45714259 ATTCCTTTGAAGAGGTAGGTTGG - Exonic
908525094 1:64980356-64980378 CCATCCCTGAAGATGTAGGTAGG + Intergenic
912730679 1:112100354-112100376 ATATATATGAAGAGGGGGGTGGG - Intergenic
913112405 1:115668194-115668216 CTATCTATTCAGAGGTAGTATGG - Intronic
914706941 1:150177935-150177957 ATATTTATGAGGAGGGAGGTGGG - Intergenic
915370848 1:155349135-155349157 CTATCTATGAAGACATTGATAGG - Intronic
917345822 1:174027330-174027352 TTATCTATAAAGAAGTAGTTGGG - Intergenic
917561569 1:176163115-176163137 CTAGCTAGGAAGGGGTAGTTTGG - Intronic
917669920 1:177263735-177263757 CTTTCTATTAACAGGGAGGTAGG + Intronic
919280343 1:195482096-195482118 CTATCTGTGAAGAGAGAAGTGGG + Intergenic
919885792 1:201933664-201933686 CTATCTTTGGAGAGGAAGCTTGG + Intronic
924398016 1:243644810-243644832 TTATCTCTGAGTAGGTAGGTGGG + Intronic
1062806572 10:424823-424845 GTTTCTTGGAAGAGGTAGGTGGG - Intronic
1064678113 10:17781984-17782006 ATTTCTATGAAGAGATAGATAGG + Intronic
1065408540 10:25395519-25395541 CTATCAAAGCAAAGGTAGGTAGG - Intronic
1065420023 10:25532811-25532833 CTATCTCTGAATAGGTTGGCTGG - Intronic
1065548541 10:26846712-26846734 TCATCTGTGAAGAGGTAGGTAGG - Intronic
1067659242 10:48222032-48222054 GGATATATGAATAGGTAGGTGGG + Intronic
1072339014 10:94428202-94428224 CTGTCTTGGAAGTGGTAGGTTGG + Intronic
1073520601 10:104125368-104125390 CTATCTAGGAAAAAGTAGGATGG - Intronic
1078207869 11:9245928-9245950 TTAATTATGAAGAGATAGGTTGG - Intronic
1078334943 11:10455832-10455854 CTTTCTGAGAAGAGGCAGGTCGG + Intronic
1078540015 11:12205864-12205886 CTTTCTCTGTAGGGGTAGGTGGG + Intronic
1082148104 11:48696464-48696486 CAATCTGTGAAGGGGTATGTGGG + Intergenic
1082148138 11:48696961-48696983 GAATCTGTGAAGAGGTAGTTGGG + Intergenic
1082590241 11:54998603-54998625 GAATCTGTGAAGAGGTAGTTGGG + Intergenic
1085889098 11:80556614-80556636 CTATCCAAGGAGAGGTAAGTGGG - Intergenic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1089226075 11:116923421-116923443 CTAATTTTGGAGAGGTAGGTTGG - Intronic
1089766910 11:120774710-120774732 CTCTCTGTGAATAGGGAGGTGGG + Intronic
1090751347 11:129748966-129748988 TCATCTATGAAGAGGCAGGAAGG - Intergenic
1092014450 12:5146525-5146547 ATATATATGAATAGGTAGGTGGG - Intergenic
1093834287 12:23807528-23807550 GAAGCTATGAAGAGGTAGGAAGG + Intronic
1094356247 12:29580794-29580816 CTATATAAGTACAGGTAGGTGGG - Intronic
1098622736 12:72623749-72623771 CTATCTATGAATATGTAAGGTGG + Intronic
1105703288 13:22949723-22949745 CCATTTCAGAAGAGGTAGGTAGG - Intergenic
1109502111 13:63251396-63251418 TTTTCTCTGAAGAGGTAGCTCGG + Intergenic
1112933610 13:104771530-104771552 CTAACTCTGAACAGTTAGGTTGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1115207274 14:30922358-30922380 GTATTTGTTAAGAGGTAGGTGGG - Intronic
1115445516 14:33485057-33485079 GTACCTTTGGAGAGGTAGGTAGG + Intronic
1115517079 14:34196177-34196199 CTTCCTAAGAAGAGGTATGTGGG + Intronic
1118009298 14:61593158-61593180 CTATCTAGGAAGAAGTATTTGGG - Intronic
1121064764 14:90952165-90952187 CTATATAGGAAGAGTCAGGTTGG - Intronic
1123137305 14:106040103-106040125 CTATATATAAAGGGGTAGGCTGG + Intergenic
1124173254 15:27396960-27396982 TTATCAATGAAGAGGTAGCATGG + Intronic
1127866059 15:63034009-63034031 CTTCCTTTGAAGAGGTAGGAGGG - Intergenic
1130812657 15:87396379-87396401 CTAGCTATTAAAATGTAGGTTGG - Intergenic
1134185217 16:12079710-12079732 CTCTCTATCCAGAGGTAGATGGG + Intronic
1138535615 16:57658783-57658805 CTATCTGTGAAGTGGGAGGATGG - Intronic
1139819757 16:69711989-69712011 ATTTCTATAAAGAGGGAGGTTGG - Intronic
1141648330 16:85379144-85379166 CCATCGAGGAAGAGGTAGGCCGG - Intergenic
1144783111 17:17817588-17817610 CTGTCTATGAAATGGGAGGTAGG + Intronic
1145778076 17:27543361-27543383 CCAGCTATGGAGAGGCAGGTTGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151867121 17:76811202-76811224 CTGTCTAAGAAGGGGGAGGTGGG + Intergenic
1153160398 18:2198284-2198306 CTATATACAAAGAGATAGGTTGG + Intergenic
1155603522 18:27576692-27576714 CTATCTCTGGAAAAGTAGGTAGG - Intergenic
1156733247 18:40222106-40222128 CTTTCTATGAAGAGGTTTATTGG - Intergenic
1157940337 18:51921670-51921692 CGATCTATGCAGAGGAAGGGTGG - Intergenic
1158102997 18:53851904-53851926 CTTTCTATGAAGAGGTACCTAGG + Intergenic
1159084921 18:63778117-63778139 CCATCTTTGAAGAGATAAGTAGG + Intronic
925416735 2:3675503-3675525 TTATCTGTGAAGAGAGAGGTGGG + Intronic
926604198 2:14880213-14880235 GTATCTATGAAAAGGTATGGGGG - Intergenic
928468486 2:31547848-31547870 CTATCTATGTAGAGAGAGGCGGG - Intronic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
931520058 2:63086658-63086680 CTTTCAATGGAGAGGTAGGGTGG - Intergenic
936827377 2:116598904-116598926 CTTTCTATGAAGAGGGATCTGGG - Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
940597619 2:155815364-155815386 CTGTCTCTGAAGCTGTAGGTGGG - Intergenic
941856026 2:170231900-170231922 CTATCTATAAAGTGGTAAGGTGG - Intronic
945345595 2:208711139-208711161 CTATCAAAGAAGAGGAAGGGAGG + Intronic
946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG + Intergenic
1171274579 20:23845237-23845259 CAATCTCTGCAGAGGAAGGTTGG - Intergenic
1176678532 21:9803913-9803935 CTTTGTACGAAGGGGTAGGTTGG - Intergenic
1177319497 21:19501703-19501725 CTTTCTAAGAAAAGGTTGGTAGG - Intergenic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1181918309 22:26298682-26298704 CTATCTATGTAGAGACAGATTGG - Intronic
949141283 3:636366-636388 CTAAAAATGAAGAGGAAGGTGGG + Intergenic
949531247 3:4957838-4957860 CTAGCAATGAAAAGGTATGTAGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951389744 3:22088317-22088339 CTATCTATGAAGAGCAAGATGGG - Intronic
953039971 3:39247480-39247502 TTGTCTATGAAGAGTTAGGTAGG - Intergenic
954221080 3:49154334-49154356 CTTTCTATGACGAGGGAGGAGGG + Intergenic
955505198 3:59625748-59625770 CTATCTATGAACAAGGAAGTGGG - Intergenic
956056722 3:65306724-65306746 ATATCCATGAAGAGGTACATTGG - Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
960726567 3:120676201-120676223 GCATCTATGAAGAGGTGTGTGGG + Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
962207711 3:133448632-133448654 GAAACTATGAAGAGGTAGGAGGG + Exonic
968826901 4:2905116-2905138 CTAACTATGAACAGTAAGGTAGG - Intronic
971168746 4:24211548-24211570 ATATCTAAGAAAAGGTAAGTTGG + Intergenic
972028152 4:34413278-34413300 CTATCTATTAAGGAGAAGGTTGG - Intergenic
972989295 4:44803860-44803882 CTTTCTATCAAGTGGCAGGTTGG - Intergenic
973268910 4:48240433-48240455 GTATTTGTGATGAGGTAGGTAGG - Intronic
975207467 4:71661830-71661852 CTATTTCTGAAGGGGTCGGTAGG - Intergenic
976863005 4:89689171-89689193 CTAGCTTTGAAGATGCAGGTAGG - Intergenic
977035955 4:91953819-91953841 CTGTTTATGAAAAGGTAAGTTGG - Intergenic
978143238 4:105341603-105341625 CTAGCTTTGAAGAGGGAGGAAGG - Intergenic
978322238 4:107510463-107510485 CTGTGTATGGAGAGGTAGTTAGG + Intergenic
979226913 4:118296626-118296648 CTATCTAAGAGGAGGAGGGTGGG + Intronic
982418786 4:155168956-155168978 CTATATAAGAAAATGTAGGTAGG - Intergenic
985397025 4:189555056-189555078 CTTTGTACGAAGGGGTAGGTTGG + Intergenic
987891482 5:23883828-23883850 CAATCTATTAAGAGACAGGTTGG - Intergenic
988713511 5:33802092-33802114 CTATCTATGAATTGGGAAGTGGG + Intronic
991985268 5:72278565-72278587 CTACCTATGAAGAAGCAGGATGG - Intronic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
993466270 5:88250565-88250587 CAATCTAAGGAGAGCTAGGTTGG + Intronic
994731730 5:103499525-103499547 CCATCTATAAAGAGGGGGGTGGG + Intergenic
995018918 5:107345378-107345400 CTATCAATGAAGAGATAGAAAGG - Intergenic
1001793312 5:174480163-174480185 GTATCCTTGAAGAGGTGGGTAGG - Intergenic
1003725495 6:8757898-8757920 ATATGTATGAAGAGGAAGGCAGG + Intergenic
1004542158 6:16561381-16561403 GTATCTGTGGAGAGGTGGGTGGG - Intronic
1004578446 6:16923087-16923109 CTATAGATGAAGAGGTAGGTAGG + Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005322902 6:24672847-24672869 CTATCGAAGAAGAGGTGGGCAGG - Intronic
1009336838 6:62501612-62501634 CTAGCTTTGAAGAGGAAGGAAGG - Intergenic
1009738519 6:67711826-67711848 TTACCTATAAAGAGGTATGTAGG - Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1012580241 6:100859696-100859718 CTATGAATCAAAAGGTAGGTTGG - Intronic
1012877366 6:104743512-104743534 CTATTTATGAAAATGTAGTTTGG - Intronic
1013165682 6:107589800-107589822 CTATCTATGAAGAGGTAGGTGGG - Intronic
1015819801 6:137248658-137248680 CCATTTATGAGGAGGTAGTTTGG - Intergenic
1016837484 6:148492941-148492963 CCATCTATGAAGAAATAGTTTGG - Intronic
1021569104 7:22046497-22046519 GTAGCTATGCAGAGGTAGGTTGG - Intergenic
1021895093 7:25226066-25226088 CTATAAAAGAACAGGTAGGTAGG + Intronic
1024386333 7:48755959-48755981 CTATCTATAAAGAGTAAGGAAGG + Intergenic
1024427602 7:49245399-49245421 CTATCTCTGAAGAGGAAGCCAGG - Intergenic
1031928053 7:127656879-127656901 CCATTTATGAAGAAGTAGATAGG + Intronic
1032871687 7:135992512-135992534 CTATCTATGGGGAGATAAGTGGG - Intergenic
1038981287 8:32762166-32762188 CAATCTATGAAAAAGTAGGCAGG + Intronic
1040483036 8:47843501-47843523 CTATCTCACTAGAGGTAGGTGGG + Intronic
1051545762 9:18272687-18272709 TTTTCTGTGAAGTGGTAGGTAGG - Intergenic
1052261215 9:26518569-26518591 TGATCAATGAAGAGGTAGTTTGG - Intergenic
1055180116 9:73377051-73377073 GTATCTGTGAAGTGGTAGATAGG + Intergenic
1055191380 9:73529050-73529072 CTATCTATACATAGGTGGGTGGG - Intergenic
1055191387 9:73529059-73529081 CTATGTATAGATAGGTAGGTAGG + Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1057822122 9:98340730-98340752 CCATTTACCAAGAGGTAGGTTGG + Intronic
1059491358 9:114670051-114670073 ATATGAATGAAGAGGCAGGTGGG - Intergenic
1061399458 9:130360450-130360472 CCATCCATGAAGAGACAGGTTGG - Intronic
1203663699 Un_KI270754v1:6452-6474 CTTTGTACGAAGGGGTAGGTTGG - Intergenic
1186194780 X:7099550-7099572 CTCTCTATGAAAAGGTGGGTGGG - Intronic
1186770629 X:12814698-12814720 CTATCTCAGCAGTGGTAGGTAGG - Intronic
1188464760 X:30467372-30467394 CTATTTAGGAAGTGGTGGGTGGG - Intergenic
1189680294 X:43508878-43508900 CTATTTATAAAGATGTGGGTGGG - Intergenic
1191771537 X:64765331-64765353 CTATTGATGAAGAGTTAGATTGG - Intergenic
1192250064 X:69404723-69404745 CTGTCTATGAACAGGAATGTGGG + Intergenic
1194355414 X:92877423-92877445 CTATCTAAGAGAAGGTAGCTTGG + Intergenic
1194897999 X:99469224-99469246 CTATCTATGCACAGGAAGGGTGG - Intergenic
1196563373 X:117177240-117177262 TTATCTATGAACAGGAAGCTTGG - Intergenic
1196705430 X:118713236-118713258 CTCTGTATGGAAAGGTAGGTGGG - Intergenic
1198449388 X:136751709-136751731 CTATCTATGAATAGGGAAGTAGG + Intronic
1201981145 Y:19911513-19911535 TTATCCATGGAGATGTAGGTGGG - Intergenic