ID: 1013167326

View in Genome Browser
Species Human (GRCh38)
Location 6:107605811-107605833
Sequence TGGGATTCTCCATGCTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013167326 Original CRISPR TGGGATTCTCCATGCTTAAC AGG (reversed) Intronic
900182843 1:1319991-1320013 GGGGCTTCTCCAGGCTTCACGGG + Intronic
902246725 1:15125535-15125557 TTGGATTCCACATGCTTGACTGG + Intergenic
902880114 1:19366495-19366517 TGGGATTCACCATGCTGGCCAGG - Intronic
904604437 1:31691138-31691160 TGGGGAGCTCCATGCTTGACAGG - Intronic
904997296 1:34640952-34640974 CGGGATTGTCCATGGTTACCTGG + Intergenic
905579386 1:39072362-39072384 GGGGTTTCACCATGCTGAACAGG - Intergenic
906044722 1:42819336-42819358 TGGGATTCTACATTCTTTATTGG + Intronic
907663229 1:56412758-56412780 TGGCATTCCCAATGCTTAGCGGG - Intergenic
908809734 1:67967846-67967868 TGGGTTTCTCCATGTTGACCAGG - Intergenic
908843745 1:68303900-68303922 TGGGTTTCTCCATGTTGACCGGG + Intergenic
909162272 1:72168202-72168224 GGGGTTTCTCCATGCTGACCAGG + Intronic
911585844 1:99689571-99689593 TGGGATCATCCATGCTGAGCTGG + Exonic
912499317 1:110111555-110111577 TGGGTTTCTCCATGCTGCCCAGG - Intergenic
914213900 1:145607401-145607423 AGGGTTTCTCCATGCTTGTCAGG + Intergenic
914465845 1:147927804-147927826 AGGGTTTCTCCATGCTTGTCAGG + Intergenic
915062625 1:153198813-153198835 TGGGATTCTCTATGCAGAGCTGG + Intergenic
916717784 1:167459868-167459890 TGGAATTCTCAATTTTTAACGGG - Intronic
920343284 1:205289253-205289275 GGGGATTCTCCATCCTTCCCTGG + Intergenic
920741680 1:208586760-208586782 TGCAATTCTCCCTGCTTACCTGG + Intergenic
922060025 1:222080026-222080048 AGGGATTTTCCATACTCAACAGG + Intergenic
922251493 1:223853011-223853033 GGGGTTTCTCCATGCTTGTCAGG + Intergenic
922671708 1:227513180-227513202 TGGGTTTCTCCATGTTGATCAGG - Intergenic
923132888 1:231092574-231092596 TGGGACTAGCCATGCTCAACTGG + Intergenic
923417981 1:233783663-233783685 TGAGATTCTCCATGTTTAAAAGG + Intergenic
1062875693 10:941263-941285 TGGGACTCTCCCTGATTAGCTGG - Intergenic
1068583139 10:58765594-58765616 TGGGATTCTCCCGTCTTGACAGG - Intronic
1068700197 10:60011513-60011535 GGGGTTTCTCCATGTTTATCAGG - Intergenic
1068958272 10:62840988-62841010 TGGGACTATCCTTGCTTTACTGG - Intronic
1069258786 10:66367336-66367358 TGGAACTCTCCATGATTACCTGG - Intronic
1071089023 10:81897647-81897669 TGGCATTCTCCATGCTTGTTAGG + Intronic
1072489614 10:95891403-95891425 TGGGATTATGGATGCTCAACTGG - Intronic
1073452746 10:103619301-103619323 TGGGATTTGCCATGCCTCACTGG - Intronic
1075968191 10:126630874-126630896 TGGGAATCACCCTCCTTAACTGG + Intronic
1081857838 11:46315204-46315226 TGGGATTCTCCAGGCCAATCAGG - Intronic
1083565575 11:63712676-63712698 TGGGGTTCTCCATGTTGATCCGG + Intronic
1084291205 11:68169545-68169567 TGCTATTCTACATGCTTTACAGG + Intronic
1084505506 11:69564379-69564401 TGAGATCATCCAGGCTTAACAGG + Intergenic
1084786133 11:71442612-71442634 TGGGATTCTCCATTTTAAAAAGG - Intronic
1085342649 11:75743520-75743542 TGGGTTTCTCCATGTTGATCAGG + Intergenic
1086511311 11:87561157-87561179 CAGGATTCTGCAGGCTTAACAGG + Intergenic
1087754759 11:102043242-102043264 TGGGTTTCTCCATGTTGACCAGG - Intergenic
1087755771 11:102053358-102053380 TGGGTTTCTCCATGTTTGTCAGG - Intronic
1088077193 11:105864677-105864699 AGGGATTCTCCATGTTTGTCAGG - Intronic
1088427973 11:109725895-109725917 GTGGATAATCCATGCTTAACTGG - Intergenic
1088691511 11:112332539-112332561 TAGCATTCACCCTGCTTAACAGG + Intergenic
1088807894 11:113368500-113368522 TGGGATTTTCCATCCTAAAGAGG + Intronic
1092379687 12:7985252-7985274 TGGGTTTCTCCATGCTGGTCAGG - Intergenic
1092622687 12:10289967-10289989 GGGGTTTCTCCATGCTTGTCAGG + Intergenic
1093353654 12:18135549-18135571 TGGAGTTCTCCAGGCTTAACGGG - Intronic
1097683407 12:62670166-62670188 AGGGATTCTCCATGCTGGTCAGG + Intronic
1099431073 12:82586780-82586802 TGGTATTCTCTATGCTTGATTGG - Intergenic
1101243917 12:102866502-102866524 TGGTATTTTCCATCCTCAACTGG + Intronic
1102312360 12:111856044-111856066 TGGGTTTCTCCATGTTGATCAGG + Intronic
1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG + Intronic
1102550933 12:113691752-113691774 TGGGATGCTCCATGCTGTAAAGG + Intergenic
1103441772 12:120968303-120968325 AGGGTTTCTCCATGTTTACCAGG + Intergenic
1107149560 13:37095855-37095877 TGTTGTTCTCCATGCTTAAGAGG + Intergenic
1107150015 13:37100100-37100122 TGTTGTTCTCCATGCTTAAGAGG - Intergenic
1108190456 13:47933105-47933127 TAGGAATCTGTATGCTTAACAGG + Intergenic
1109098256 13:58144998-58145020 GGGGATTCTCCATGTTGATCAGG - Intergenic
1109197179 13:59390901-59390923 TTGGATTCTCTCTGCTTTACTGG + Intergenic
1111003422 13:82215830-82215852 TGGGAGTCTCCCTGCTTAGGTGG + Intergenic
1112800607 13:103105623-103105645 TGGGTTTCTCCATGTTGATCAGG + Intergenic
1113685094 13:112277575-112277597 TGGAATGGTCCATGCTTACCTGG - Intergenic
1113685389 13:112279309-112279331 AGGGATGGTCCATGCTTACCTGG - Intergenic
1113685568 13:112280329-112280351 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113685658 13:112280873-112280895 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113686537 13:112285801-112285823 AGGGATGGTCCATGCTTACCTGG - Intergenic
1113686697 13:112286718-112286740 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113687230 13:112289778-112289800 AGGGATGGTCCATGCTTATCTGG - Intergenic
1113687329 13:112290356-112290378 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113687421 13:112290900-112290922 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113688669 13:112297904-112297926 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113689715 13:112303716-112303738 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113689842 13:112304430-112304452 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113690732 13:112309426-112309448 AGGAATGGTCCATGCTTAACTGG - Intergenic
1113691483 13:112314082-112314104 TGGAATGGTCCATGCTTACCTGG - Intergenic
1113691766 13:112316125-112316147 AGGAATGATCCATGCTTAACTGG - Intergenic
1114359666 14:21957853-21957875 TTAGATTCTCCAAGGTTAACGGG - Intergenic
1114813147 14:25925017-25925039 AGGGTTTCTCCATGTTTATCAGG - Intergenic
1116212952 14:41971815-41971837 TCACATTCTGCATGCTTAACAGG + Intergenic
1116973106 14:51088394-51088416 TGAGACTCTCCATTCTGAACAGG - Intronic
1117388340 14:55239054-55239076 GGGGTTTCTCCATGTTTATCAGG + Intergenic
1119227169 14:72953189-72953211 TGGGATTCTCCATGTTGGTCAGG + Intronic
1121198754 14:92099019-92099041 TGTGATTCTCCCTTCTTATCAGG - Intronic
1125095197 15:35842534-35842556 TGGGAATCCCTATGCTTAAGAGG - Intergenic
1125128762 15:36256630-36256652 TGGGTTTCTTCATGCGTCACTGG + Intergenic
1125620487 15:41057261-41057283 GGGGTTTCTCCATGCTGCACAGG - Intronic
1125877598 15:43163840-43163862 TGAGATTCTGCATTCCTAACAGG + Intronic
1125924152 15:43548439-43548461 AGGGTTTCTCCATGCTGATCAGG + Intronic
1126718870 15:51554744-51554766 TAGCATGCTCCATGCTTACCAGG - Intronic
1126838654 15:52694355-52694377 AGGGTTTCTCCATGTTGAACAGG + Intronic
1127981669 15:64039799-64039821 TGGGATTCTCCATGGTTCCCAGG - Intronic
1129782741 15:78284566-78284588 TGGGATTCTGCATTTCTAACAGG - Intronic
1133038660 16:3048028-3048050 GGGGTTTCTCCATGCTGATCAGG + Intronic
1133653757 16:7838850-7838872 TGGGTTTCTCCATGTTGACCAGG - Intergenic
1135030963 16:19038384-19038406 TGGGTTTCTCCATGTTGATCAGG + Intronic
1135223060 16:20630276-20630298 GGGGTTTCTCCATGTTTATCAGG + Intronic
1135500807 16:22994335-22994357 TTGTATTCTCCATGCCTAAGTGG - Intergenic
1137039036 16:35592631-35592653 GGGGATTCTCCATGTTGGACAGG + Intergenic
1142622668 17:1174913-1174935 TGGGATTCTCCAAGCAGATCTGG - Intronic
1143116817 17:4585742-4585764 TGGGATTTTCCATCCTGATCAGG + Intronic
1144624254 17:16836737-16836759 TGGGCTTCTCTATGCTCACCAGG - Intergenic
1144882175 17:18435982-18436004 TGGGCTTCTCTATGCTCACCAGG + Intergenic
1145150058 17:20508404-20508426 TGGGCTTCTCTATGCTCACCAGG - Intergenic
1147413583 17:40272208-40272230 TGGGTTTCTCCATGTTGATCAGG + Intronic
1151710450 17:75802037-75802059 TGGGATTCTCCATGTTGGCCAGG + Intronic
1154209579 18:12367974-12367996 AGGGTTTCTCCATGTTGAACAGG - Intronic
1154968036 18:21379131-21379153 TGTGATCCTCCATGTATAACTGG + Intronic
1159113805 18:64090390-64090412 TGTGTGTCTGCATGCTTAACAGG - Intergenic
1160243400 18:77138358-77138380 ACGGATTCTCCATGCTGCACAGG + Intergenic
1162120704 19:8465458-8465480 TGAGATTATCCATGCATTACAGG + Exonic
1162259949 19:9524588-9524610 AGGGATTCTCCATGTTGATCAGG - Intergenic
1163351456 19:16778698-16778720 TGGGTTTCTCCATGTTGGACAGG + Intronic
1164702387 19:30295123-30295145 TGAGATTCTGCATACTTAACAGG + Intronic
1165689057 19:37848739-37848761 GGGGTTTCTCCATGCTTGCCAGG - Intergenic
1166513906 19:43431338-43431360 TGGGTTTCTCCATGTTGATCAGG - Intergenic
925749215 2:7072468-7072490 TGGGATTCTACAAGCCTGACAGG - Intergenic
926680229 2:15657502-15657524 GGGGTTTCTCCATGTTAAACAGG - Intergenic
927047626 2:19295868-19295890 GGGGTTTCTCCATGTTTATCAGG - Intergenic
927897152 2:26790515-26790537 TGGGTTTCTCCATGTTCATCAGG + Intronic
931621896 2:64218929-64218951 TGGGTTTCTCCATGTTTGTCAGG + Intergenic
932428568 2:71659434-71659456 TGGGACTCTCAATGGTTAATGGG + Intronic
933672312 2:85020617-85020639 TGGGTTTCTCCATGTTTCCCAGG + Intronic
934131427 2:88952810-88952832 TGGGAATCTCCATGTTTGGCTGG - Intergenic
935299320 2:101680133-101680155 TGTGGTTCTCCATGCTTCTCAGG + Intergenic
935681208 2:105638805-105638827 TGGGATTCTCCATGTTGGCCAGG + Intergenic
936642023 2:114324023-114324045 TGAGATTCTACATCATTAACAGG - Intergenic
936955538 2:118018673-118018695 TGGGATTTTCAAAGCTTCACAGG + Intergenic
938890870 2:135704169-135704191 TGGGTTTCACCATGCTGACCAGG + Intronic
939337122 2:140844253-140844275 TGGGTTTCTCCATGTTGATCAGG + Intronic
940074472 2:149725794-149725816 TGGGATTATCAATGCATGACAGG - Intergenic
941706776 2:168667158-168667180 TGGGATTTTCTGTGTTTAACAGG + Intronic
942250551 2:174044051-174044073 TGGGTTTCTCCATGTTGATCAGG - Intergenic
944748101 2:202678533-202678555 TGGGAATCTCCATGTTTGAGTGG + Intronic
945200797 2:207278896-207278918 TGGGATTATTCATGGTCAACTGG + Intergenic
1168875612 20:1170167-1170189 TGAGATTCTGCATGTGTAACAGG - Intronic
1169347032 20:4836743-4836765 TGGGTTTCTCCATGTTAACCAGG - Intergenic
1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG + Intronic
1171383842 20:24753614-24753636 TGGGATTCTGCATTTCTAACCGG - Intergenic
1172516582 20:35538481-35538503 TGGGATTCTGCATTTCTAACAGG + Intergenic
1172953576 20:38738923-38738945 TGGGATTCTCCATGTTGGTCAGG + Intergenic
1179108553 21:38425190-38425212 TGGGTTTCTCCATGTTGATCAGG - Intronic
1183768055 22:39897708-39897730 TGGGTTTCTCCATGTTGATCAGG + Intergenic
1185165452 22:49259566-49259588 TGGAATTGTGCATGATTAACTGG - Intergenic
949215126 3:1558297-1558319 TGGGTTTCGCCATGTTGAACAGG - Intergenic
950313029 3:11975592-11975614 TGGGATTAACCCTGCTTTACTGG - Intergenic
951218698 3:20047261-20047283 TGGGTTTCGCCATGTTTAACAGG + Intronic
952058976 3:29483574-29483596 AGTGGTTCTCCATGTTTAACGGG - Intronic
952481109 3:33762503-33762525 TGGGTTTCACCATGTTGAACAGG + Intergenic
952509760 3:34041285-34041307 GGGGATTCTCCATGTTGATCAGG - Intergenic
952713914 3:36458930-36458952 TGAGATTCTGCATTCCTAACAGG + Intronic
953448789 3:42989579-42989601 TAGGATTTTCCATGATAAACAGG - Intronic
956242614 3:67147302-67147324 TGGGTTTCTCCATGTTGGACAGG - Intergenic
958436714 3:94105693-94105715 TGAAATTCTACATGCTTAACCGG - Intronic
958529932 3:95314852-95314874 TGGGTTTCTCCATGTTTGCCAGG - Intergenic
959750058 3:109823579-109823601 TGAGCTTCTCTATTCTTAACTGG + Intergenic
963169739 3:142238829-142238851 TGGGTTTCTCCATGTTGATCAGG - Intergenic
963386925 3:144608957-144608979 CTGGATTCTCCATGCTTTATTGG - Intergenic
966936416 3:184712361-184712383 TGGGATTTTCAGTGCTTTACCGG + Intergenic
967120473 3:186378262-186378284 TGAGATTCTCCATGGCAAACTGG - Intergenic
968700847 4:2057743-2057765 TGGGATTCTCAAAGATTATCTGG + Intergenic
969295013 4:6264635-6264657 CGGGATTCTGCATTCGTAACAGG + Intergenic
972547887 4:40098627-40098649 TGGTTTTCTACATGCATAACTGG - Intronic
975388131 4:73782633-73782655 GGGGTTTCTCCATGTTTACCAGG + Intergenic
975891097 4:79028630-79028652 TTGGATTATCCATACTTCACGGG + Intergenic
977107564 4:92907599-92907621 TGGGTTTCTCCATGCTTGTCAGG + Intronic
978104822 4:104889263-104889285 TAGGGTTCTTCATGCATAACTGG - Intergenic
984639672 4:182147590-182147612 TGTAATTCAACATGCTTAACAGG - Intronic
987099084 5:14576954-14576976 TGGGATTCACCATGCTGGCCAGG + Intergenic
990196706 5:53325121-53325143 TGGGATTCTCCAGTTTTATCAGG - Intergenic
991585379 5:68196517-68196539 GGGGTTTCTCCATGTTTACCAGG + Intronic
992671589 5:79066485-79066507 GGGGTTTCTCCATGCTAACCGGG + Intronic
995189760 5:109308010-109308032 TGGGTTTCTCCATGCTGAAGAGG + Intergenic
995712715 5:115051290-115051312 TGGGATTCTCCTGGATTATCTGG + Intergenic
996890719 5:128416214-128416236 GGGGTTTCTCCATGTTGAACAGG + Intronic
1000581009 5:163035409-163035431 TGGGTTTCACCATGCTGACCAGG - Intergenic
1003402329 6:5800746-5800768 GGGGTTTCTCCATGTTTACCAGG + Intergenic
1004225656 6:13782128-13782150 GGGGTTTCTCCATGTTGAACAGG + Intergenic
1005769348 6:29050845-29050867 GGGGTTTCTCCATGTTTATCAGG - Intergenic
1007253183 6:40510356-40510378 TGGGAATCTCCAGCCTTACCTGG - Intronic
1008225046 6:48904717-48904739 TGGGTTTCTCCATGTTGATCAGG + Intergenic
1008276377 6:49549245-49549267 TGGGTTTCACCATGCTGACCAGG + Intergenic
1008933545 6:56964955-56964977 TTGCATTCTCCATCCTTAACTGG + Intronic
1013167326 6:107605811-107605833 TGGGATTCTCCATGCTTAACAGG - Intronic
1015433851 6:133162663-133162685 GGGGTTTCTCCATGCTTGCCAGG + Intergenic
1015441478 6:133251869-133251891 TAGGATTCTCCACACTTGACTGG - Intronic
1016288286 6:142498893-142498915 TGTGATGATCCATGCTTTACAGG + Intergenic
1017487107 6:154913476-154913498 TGGGGTTCACCATGCTGGACTGG + Intronic
1020663911 7:11015318-11015340 TGGGATTCTCCAAGATTCAATGG - Intronic
1020834568 7:13132824-13132846 TAGGTTTCTTCATGCTTCACAGG - Intergenic
1021884023 7:25120931-25120953 AGGGTTTCTCCATGCTGGACAGG - Exonic
1022112468 7:27239890-27239912 TGGGATTGCCCAGGCTTAATGGG + Intergenic
1024376428 7:48643866-48643888 TGTGATTCTGCATGTCTAACAGG - Intronic
1024921203 7:54556837-54556859 TGGGTTTTTCCATTCATAACTGG + Intronic
1025101163 7:56136365-56136387 TGGGTTTCTTCTTGCTTACCAGG + Intergenic
1027380543 7:77604404-77604426 GGGGATTCTCCATGTTTGTCAGG + Intronic
1028729005 7:94123410-94123432 TGGGGTTATCCATGTTTAAGTGG + Intergenic
1029002046 7:97164564-97164586 TGGGTTTCTCCATGTTGATCAGG + Intronic
1030760147 7:113340500-113340522 TGGGATGCTCTTTGCTTAACTGG + Intergenic
1030803968 7:113890325-113890347 TGGGAATCTGCATTTTTAACTGG + Intronic
1030803975 7:113890413-113890435 TGGGAATCTGCATTTTTAACTGG + Intronic
1030876335 7:114817776-114817798 TGGGTTTCTCCATGTTTGTCAGG + Intergenic
1033320746 7:140337521-140337543 TTGGACTCTGCATGCTTAAATGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035280311 7:157774394-157774416 TAGGATTCACCAGGCTTGACAGG - Intronic
1036233457 8:7019132-7019154 TAGGAGTTTCCATCCTTAACTGG + Intergenic
1039242048 8:35567757-35567779 TGGGATTCTCCAAGCCAAAGAGG - Intronic
1041933544 8:63312275-63312297 TGGGTTTCACCATGCTGACCAGG - Intergenic
1045549300 8:103155855-103155877 TGAGATTCTGCATGTTTGACAGG + Intronic
1046460915 8:114534909-114534931 TGGGATTCTCCCTTATTCACTGG + Intergenic
1046944417 8:119961223-119961245 GGGGTTTCTCCATGCTCATCAGG - Intronic
1048515564 8:135106527-135106549 GGGGTTTCTCCATGTTTATCAGG - Intergenic
1048689157 8:136939439-136939461 TTTGATTCTCCATGGCTAACTGG + Intergenic
1051581940 9:18686110-18686132 TGGGGTTCTCCATGTTTCCCAGG + Intronic
1051872661 9:21756526-21756548 TAGGATTCGGCATCCTTAACTGG + Intergenic
1052490434 9:29159933-29159955 TGGGATTCTTCATTTTTAAAAGG - Intergenic
1052577362 9:30307216-30307238 CGGGTTTCACCATGCTTATCAGG + Intergenic
1053363297 9:37504809-37504831 TAGGATTCTACATGCTAATCAGG - Intergenic
1056194532 9:84216464-84216486 TGGTTTTCTCCATGCTGATCAGG + Intergenic
1061926245 9:133807429-133807451 TGGGGTGCTCCATGCTTACTGGG + Intronic
1062535714 9:137020302-137020324 TGGGACGCTCCATGTTTGACAGG - Intronic
1188049412 X:25466252-25466274 TGGGATTCTCCAGGCTGATGAGG + Intergenic
1188604747 X:32014583-32014605 AGGGATCCTCCTTGCTTATCAGG - Intronic
1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG + Intergenic
1190659101 X:52638455-52638477 TGGGTTTCACCATGCTTGCCAGG - Intergenic
1192286036 X:69736961-69736983 TGGGTTTCACCATGCTGACCAGG + Intronic
1192566136 X:72165166-72165188 AGGGTTTCTCCATGTTTATCAGG + Intergenic
1197490673 X:127113158-127113180 TGGGATATTCCTTGCTAAACTGG - Intergenic