ID: 1013170686

View in Genome Browser
Species Human (GRCh38)
Location 6:107634542-107634564
Sequence CCCTGGCGACTCCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013170671_1013170686 24 Left 1013170671 6:107634495-107634517 CCCCCCAACGGGTTCTCCAGCAA 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170673_1013170686 22 Left 1013170673 6:107634497-107634519 CCCCAACGGGTTCTCCAGCAACG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170670_1013170686 29 Left 1013170670 6:107634490-107634512 CCAAGCCCCCCAACGGGTTCTCC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170676_1013170686 20 Left 1013170676 6:107634499-107634521 CCAACGGGTTCTCCAGCAACGGG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170672_1013170686 23 Left 1013170672 6:107634496-107634518 CCCCCAACGGGTTCTCCAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170679_1013170686 8 Left 1013170679 6:107634511-107634533 CCAGCAACGGGGAGAACTTCATT 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97
1013170674_1013170686 21 Left 1013170674 6:107634498-107634520 CCCAACGGGTTCTCCAGCAACGG 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013170686 Original CRISPR CCCTGGCGACTCCGCGGCGG CGG Exonic