ID: 1013170790

View in Genome Browser
Species Human (GRCh38)
Location 6:107634941-107634963
Sequence CTGGGTCGCCGGCGGCGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013170790_1013170803 -4 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170803 6:107634960-107634982 CCAGGCCCGGGCGCCCCGGCGGG 0: 1
1: 0
2: 5
3: 46
4: 387
1013170790_1013170806 4 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170806 6:107634968-107634990 GGGCGCCCCGGCGGGCCCCGAGG 0: 1
1: 0
2: 4
3: 52
4: 388
1013170790_1013170811 13 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170811 6:107634977-107634999 GGCGGGCCCCGAGGCGGCCGCGG 0: 1
1: 0
2: 14
3: 48
4: 581
1013170790_1013170801 -5 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170801 6:107634959-107634981 CCCAGGCCCGGGCGCCCCGGCGG 0: 1
1: 0
2: 7
3: 39
4: 410
1013170790_1013170807 7 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170807 6:107634971-107634993 CGCCCCGGCGGGCCCCGAGGCGG 0: 1
1: 0
2: 0
3: 24
4: 245
1013170790_1013170799 -8 Left 1013170790 6:107634941-107634963 CCCGCCCGCCGCCGGCGACCCAG 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1013170799 6:107634956-107634978 CGACCCAGGCCCGGGCGCCCCGG 0: 1
1: 0
2: 6
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013170790 Original CRISPR CTGGGTCGCCGGCGGCGGGC GGG (reversed) Exonic
900413906 1:2526400-2526422 GCGGGGCGCCGGCGGTGGGCCGG - Intronic
900494433 1:2970088-2970110 CTGGGTGGCCGGTGGTGCGCCGG - Intergenic
901629028 1:10639250-10639272 CGGGGGCGGCGGCGTCGGGCGGG + Exonic
901641351 1:10694630-10694652 CCGGGCGGCGGGCGGCGGGCGGG - Intronic
903658508 1:24963277-24963299 CTGGGTGGCCGGCTCGGGGCAGG - Intronic
903732092 1:25504037-25504059 CTGGGTGGCAGGCGGGGAGCTGG - Intergenic
904034341 1:27550917-27550939 CTGTGTCGCCGGCGGAAAGCCGG - Exonic
905317343 1:37091743-37091765 CCGGGTGGCAGGCGGGGGGCGGG - Intergenic
906078412 1:43068405-43068427 CGGGGGCGGCGGGGGCGGGCTGG + Intergenic
907258356 1:53197116-53197138 CTGGGACGGCGGCGGGCGGCGGG - Intronic
911072980 1:93847006-93847028 CTGGGTCGGGCGCGGCGGCCGGG + Intronic
913129731 1:115828707-115828729 CTGCGCGGGCGGCGGCGGGCTGG + Intergenic
914244371 1:145874821-145874843 CTGAGCCGGCGGCGGCGGGGCGG - Exonic
919810375 1:201405519-201405541 CTGGGCAGCCGGGGGCGGGGGGG - Exonic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
922705650 1:227788758-227788780 CTAGGTCCCCGGCGCTGGGCAGG - Intergenic
923400765 1:233614048-233614070 CGGGGGAGCGGGCGGCGGGCGGG + Exonic
924052292 1:240091773-240091795 AGGGGGCGGCGGCGGCGGGCGGG + Intronic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
924776007 1:247114768-247114790 CTGGGTAGCAGGCGGGGGGTGGG + Intergenic
1063461058 10:6215324-6215346 CTGGGCCGCGGGCGTAGGGCTGG + Intronic
1063461080 10:6215400-6215422 CTGGGCCGCGGGCGTAGGGCTGG + Intronic
1065024350 10:21526509-21526531 CTGGGAGGGCGGCGGCGGGTCGG - Intergenic
1066432241 10:35363022-35363044 GTGGGCCGCCGGCGGCCGGGCGG + Intronic
1067694327 10:48524141-48524163 CCGGGGCGCAGGCGGCAGGCGGG - Intronic
1069760720 10:70809321-70809343 CAGGGTAGCCGGGGGCGGGGGGG - Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1069882397 10:71601946-71601968 CTGGGTGGGCGGCGGAGGGGGGG + Intronic
1070877258 10:79826012-79826034 AGGGGTCCCGGGCGGCGGGCGGG - Intergenic
1071643755 10:87342056-87342078 AGGGGTCCCGGGCGGCGGGCGGG - Intergenic
1072926280 10:99620200-99620222 CCGGGGGGCCGGCGGCGGGGAGG - Exonic
1075521843 10:123148091-123148113 CCGGGTCTCCGGCGGCGCGGAGG - Intergenic
1075782437 10:125026173-125026195 CTGGCTGGCCGGCGGCAGGGTGG + Exonic
1075801984 10:125159823-125159845 CTGGGTCGCCGGCGGCCCCCGGG + Intronic
1076362464 10:129898873-129898895 AGGGGACGCCGGCCGCGGGCCGG - Intronic
1076374266 10:129972947-129972969 CGGCGGCGCCGGCTGCGGGCCGG + Intergenic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077250060 11:1557003-1557025 CGGGGGAGCCGGCGGGGGGCCGG + Exonic
1077787895 11:5404139-5404161 CTGGGTCGGGGGCGGGGGGAGGG + Intronic
1078390267 11:10931059-10931081 CTGGGGCGCCGGCAGCGCGGCGG + Intergenic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1083246225 11:61429990-61430012 GTGTGACGCCGGCGGCGGGGGGG - Intronic
1083648267 11:64185651-64185673 CTGTGTCGCCGGCGGCTGCGGGG - Exonic
1083648457 11:64186413-64186435 GAGGGCCGCGGGCGGCGGGCGGG + Intronic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084387853 11:68855321-68855343 CTGGGTCGGCGGCGGCTGGCAGG + Intergenic
1084979714 11:72822591-72822613 CTGGGTCGCCGCAGGCAGGCGGG - Intronic
1085039567 11:73318916-73318938 CAGGGCCGCCAGAGGCGGGCAGG - Intronic
1085284626 11:75351726-75351748 CGGGGGCGGCGGCGGCGGCCGGG - Intergenic
1090799085 11:130159672-130159694 CAGGGCCGGCGGGGGCGGGCAGG + Exonic
1091218618 11:133918217-133918239 CTGGGCGGGCGGGGGCGGGCAGG - Intronic
1092230300 12:6772443-6772465 CTGGGGTGCGGGGGGCGGGCCGG + Intergenic
1092743219 12:11649804-11649826 CGGGGGCGCCGGCTGCGGGTGGG + Intergenic
1097107700 12:56635034-56635056 CTGGGCCGGCGGCGGCGGAGGGG + Intronic
1102025770 12:109713762-109713784 CTGGGCCGCGGGGGGCGGGCGGG + Intergenic
1104692693 12:130838924-130838946 CTGGGGCGGGGGCTGCGGGCAGG - Intronic
1104983381 12:132583607-132583629 CGAGGGCGGCGGCGGCGGGCGGG - Exonic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1106422618 13:29595894-29595916 CTGGGGTTCCCGCGGCGGGCGGG + Intergenic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1112415450 13:99200508-99200530 CTGGATTGCCGGCGCTGGGCAGG - Intergenic
1112494805 13:99896163-99896185 CCGGGCGGCCCGCGGCGGGCGGG - Exonic
1112503023 13:99956753-99956775 CTGGGACCCGGGCCGCGGGCTGG + Intergenic
1113311914 13:109140592-109140614 CCGGGCCGCCGTCGTCGGGCAGG - Exonic
1113904110 13:113811408-113811430 CTGGGTCTCCGGGGGAGGGGAGG + Intronic
1115284851 14:31705352-31705374 GCGGGTCGCCGGCTGCTGGCTGG + Intronic
1115664480 14:35533449-35533471 CTCGGAGGCTGGCGGCGGGCAGG + Intergenic
1118887595 14:69879643-69879665 CTGGGCAGCCGGCAGCGAGCGGG - Exonic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1123035519 14:105470276-105470298 CTGAGGGGCGGGCGGCGGGCTGG - Exonic
1123480670 15:20628682-20628704 CGGTGCTGCCGGCGGCGGGCGGG + Intergenic
1123637339 15:22371685-22371707 CGGTGCTGCCGGCGGCGGGCGGG - Intergenic
1125880057 15:43185717-43185739 CTGGGGCGGCGGCGGGGAGCCGG + Intronic
1126150919 15:45522883-45522905 CTGGGGCGCCCGCGATGGGCGGG + Intergenic
1127165550 15:56243046-56243068 GTGGGTGGGGGGCGGCGGGCGGG - Intronic
1127753495 15:62068178-62068200 CTGAGTCGCGCGCTGCGGGCTGG + Exonic
1127763562 15:62164413-62164435 CTGAGTCGCGCGCTGCGGGCTGG - Exonic
1127877237 15:63121988-63122010 CTGGGTCGGGGGCCTCGGGCTGG + Exonic
1128547740 15:68579199-68579221 CGGGGGCGGCGGCGGCGGCCCGG - Exonic
1129144250 15:73633098-73633120 GCGGGGCGCCGGGGGCGGGCCGG - Intronic
1129382859 15:75178724-75178746 CTCGGACACAGGCGGCGGGCGGG - Intergenic
1129386708 15:75200483-75200505 CAGGGTCGCCGGCGCGGTGCTGG + Intronic
1129387139 15:75202310-75202332 CTGGGTCTCCGGCGGAGAACAGG + Intronic
1129406507 15:75322637-75322659 CTGGGTGGCGGGCGGCGTGGGGG + Intergenic
1130540344 15:84817355-84817377 CGGGAGCGGCGGCGGCGGGCAGG + Exonic
1132251897 15:100341038-100341060 CTGCGGCGCCGCCGGCGGCCTGG - Exonic
1132578752 16:675744-675766 CGGGGTCGGCGGCCGCGGCCGGG - Exonic
1132815835 16:1826255-1826277 CGGGGGCTCCGGCGCCGGGCGGG + Intronic
1132828900 16:1918149-1918171 CGGGGGCGCGGGCGGCCGGCGGG + Exonic
1133188554 16:4116696-4116718 CTGGGACGCCGAGGGAGGGCGGG - Intergenic
1133270545 16:4609087-4609109 CTGGGGAGGGGGCGGCGGGCAGG + Exonic
1140740797 16:77939376-77939398 GTGGGGGGCCGGAGGCGGGCGGG + Intronic
1141830121 16:86505732-86505754 CGGGGGCGGCGGCGGCCGGCGGG + Intergenic
1142712427 17:1730709-1730731 CTGAGTCGCCAGTGGAGGGCCGG - Intronic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142971159 17:3612606-3612628 GTGGGTTGCAGGCTGCGGGCTGG + Intronic
1144692904 17:17280703-17280725 CTAGGCCGCCGGGAGCGGGCGGG - Intronic
1145912898 17:28552641-28552663 CTGGGGCCCCGGCCGGGGGCGGG - Exonic
1146473840 17:33145927-33145949 CTGGGTCGGCTGTGGCGGGAGGG - Intronic
1147369368 17:39981047-39981069 CTGGGGGGCCGGCGGCGGTGGGG - Exonic
1147393361 17:40122920-40122942 CTTGGTGGCCGGGGGCGGACAGG - Intronic
1147989642 17:44324868-44324890 CTGGTCGGCCCGCGGCGGGCGGG - Intronic
1148059884 17:44829573-44829595 CTGCGTCTCCGGCGGCGTGCGGG - Intronic
1148493469 17:48037815-48037837 GCGGGGCGGCGGCGGCGGGCAGG - Intronic
1148601725 17:48899280-48899302 CTGGGGCGGCGGGGGCGGGGGGG + Intergenic
1149712572 17:58756335-58756357 CTGGGGCGGCGGCGGCGGCACGG - Exonic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152644192 17:81461249-81461271 AAGGGTGGGCGGCGGCGGGCGGG + Exonic
1154416731 18:14179302-14179324 CTGGGTCGGCGGGGGCGTGGGGG + Intergenic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1160927833 19:1555584-1555606 CTGGGTGGCCGGCGTGCGGCAGG + Exonic
1161038224 19:2096916-2096938 TTGGTTGGCCGGCGGCGGGCCGG + Exonic
1161194676 19:2979798-2979820 GTGTGTTGCCGGGGGCGGGCGGG + Intronic
1161266408 19:3366680-3366702 CGGGGGCGCCGGCGGGGGGCCGG - Intronic
1161338670 19:3728686-3728708 CTGGAGGGCCGGCGGAGGGCAGG + Exonic
1161339027 19:3730544-3730566 CCTGGTCGCCGGGGCCGGGCCGG + Exonic
1161973398 19:7596170-7596192 CGGGGTCGGGGGCGGCGGGCCGG + Intronic
1162021359 19:7869923-7869945 CGAGGGCGGCGGCGGCGGGCCGG + Exonic
1163334336 19:16661146-16661168 CCGGGCCGCGGGCGGCGGGACGG + Exonic
1165058614 19:33194396-33194418 CGGGGACGCCGGGGCCGGGCGGG + Intronic
1165123855 19:33580549-33580571 CTGGCTCGCCAGGGGCTGGCAGG + Intergenic
1165767803 19:38361862-38361884 GTGGGCGTCCGGCGGCGGGCGGG + Intronic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1166307068 19:41940982-41941004 CGGGGCAGCCGGCGGCGGGAGGG - Intergenic
1166564342 19:43754604-43754626 CTAGCGCACCGGCGGCGGGCGGG - Intronic
1166671169 19:44710387-44710409 CTGGGTGGCCCGGGGTGGGCAGG + Intronic
1166808268 19:45499669-45499691 CTGGGTCGTAGGAGCCGGGCCGG + Intronic
1166897913 19:46035767-46035789 CTGGGTCGCCTGTAGCGGGGTGG + Intergenic
1166983895 19:46648756-46648778 CTGGGACGCCGGGGGCCTGCGGG - Exonic
1167077133 19:47256814-47256836 CTGGGCCGGCGGCTGTGGGCGGG + Intronic
1167414363 19:49362387-49362409 CTGGGGAGCCGCGGGCGGGCGGG + Intronic
1167476047 19:49701444-49701466 CTGGGGCGGCCGGGGCGGGCCGG + Intronic
1168092648 19:54095833-54095855 CTGGGGCGGAGGAGGCGGGCCGG + Exonic
1168272639 19:55258489-55258511 CGGAGCCGCCGGCGGCGGGGCGG - Exonic
927881506 2:26692845-26692867 CCGGGGGGCCGGCGGCGGCCCGG + Exonic
927943998 2:27123789-27123811 CCGGGGCACCGGCGGTGGGCGGG + Intronic
928998699 2:37324773-37324795 AAGGGGCGCCGGAGGCGGGCGGG - Intronic
929188694 2:39120705-39120727 CCGGGGCGGCGCCGGCGGGCCGG - Intronic
929501655 2:42494984-42495006 CTGTCTCGCCTCCGGCGGGCTGG - Exonic
929983182 2:46699472-46699494 CCGGGGAGCAGGCGGCGGGCCGG - Intronic
930011425 2:46941040-46941062 CGGGGGCGGCGGCGGGGGGCGGG + Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931762888 2:65432384-65432406 CGGGGTCGCCCCCGGGGGGCCGG + Intronic
932611410 2:73202845-73202867 CTGGGAGGCCGCCGGCGCGCAGG - Exonic
932820710 2:74897504-74897526 ATGGGGCGGCGGCGGCGGGGAGG - Intergenic
933728054 2:85437615-85437637 CCGGGTGGCCGGCGGCCTGCAGG + Intergenic
934079068 2:88452325-88452347 CTGCGGCGGCGGCGGAGGGCGGG + Exonic
935904459 2:107827685-107827707 CTGGCTGGGCGGCGGCGGCCTGG + Intronic
935904968 2:107829681-107829703 CTGGGGGGACCGCGGCGGGCGGG + Intronic
936126745 2:109794753-109794775 CTGGGGGGACCGCGGCGGGCGGG + Intronic
936217952 2:110576733-110576755 CTGGGGGGACCGCGGCGGGCGGG - Intronic
936412918 2:112276074-112276096 CTGGGGCGGCGGGAGCGGGCCGG + Intronic
936427289 2:112432807-112432829 CTGGGGGGACCGCGGCGGGCGGG - Intronic
938303008 2:130229352-130229374 GTGGGGCGCCAGCTGCGGGCTGG + Intergenic
939189846 2:138902809-138902831 CTGGGCGGTCGGCGCCGGGCAGG + Intergenic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941951347 2:171160333-171160355 CGGGCTCGGCGGCGGCGGCCAGG - Exonic
944766598 2:202871316-202871338 CTGGGTCCCCTGCGGCGGAAGGG - Exonic
947399007 2:229714195-229714217 CAGGCTCGCCGGCGGGGGCCGGG + Exonic
947549809 2:231037959-231037981 GTGCGCGGCCGGCGGCGGGCCGG + Exonic
1172083220 20:32358681-32358703 CTGGGGCGGCGGCGGCGGTGGGG - Exonic
1173586748 20:44188002-44188024 CTGGGTCTGCGGCAGGGGGCAGG - Intergenic
1174246713 20:49187779-49187801 CTGGGGCGCAGGCGGGGGGGGGG - Intronic
1175358613 20:58389542-58389564 CTGGGGCGGAGGCCGCGGGCAGG - Intronic
1175439705 20:58981691-58981713 CTGCGACCCCCGCGGCGGGCGGG + Intronic
1175993634 20:62802390-62802412 CTGGGTCGCCCTGGGTGGGCAGG - Intergenic
1176143258 20:63554223-63554245 CTGGGGCGGCGGCGGGGGCCGGG + Exonic
1176809656 21:13525099-13525121 GTTGGTCGCCGGTGGCCGGCAGG + Intergenic
1179466824 21:41581430-41581452 CTGGGTCCTGGGCGGCGGGCGGG - Intergenic
1179998104 21:44983158-44983180 CGGGGTGGCTGCCGGCGGGCGGG + Intergenic
1180090273 21:45530732-45530754 GTGGGAAGCCGGGGGCGGGCAGG - Intronic
1180614770 22:17120230-17120252 CGGGGGCGCCGGCGGCGCGGGGG - Exonic
1180866427 22:19122452-19122474 CTGCGTCGCGGGCGGGAGGCGGG - Exonic
1182552173 22:31106437-31106459 CTGGGCCGCAGGTGGCAGGCAGG - Intronic
1183093962 22:35541224-35541246 CAGGGCCGGCGGCGGCGAGCCGG + Exonic
1183201410 22:36387757-36387779 CCGGGCAGGCGGCGGCGGGCGGG - Intronic
1183525000 22:38317492-38317514 CCGGGGCGGCGGCGGCGGGCCGG - Intronic
1184557393 22:45240748-45240770 CGGGGGCGGCGGCGGCGGGGAGG + Intronic
1185330754 22:50251137-50251159 CTGGGGCGCAGGCGGGCGGCGGG + Exonic
951558834 3:23945941-23945963 CTGAGGCGGCGGCGGCGGGCGGG + Intronic
953974396 3:47371393-47371415 TTGGGGGGCCGGCGGCGGGGTGG - Intergenic
954113138 3:48446904-48446926 CCCGGTGCCCGGCGGCGGGCCGG - Exonic
955246269 3:57227801-57227823 CGGGGTCAGCTGCGGCGGGCGGG + Exonic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
961328392 3:126125000-126125022 CTGGGAGGCAGGCAGCGGGCAGG + Intronic
961372397 3:126439682-126439704 CTGGGCCGCGGGCCGAGGGCAGG + Exonic
961965078 3:130894032-130894054 CTGGGCGGCCGGCGGCGGGGAGG + Intronic
962520743 3:136195847-136195869 GCGGGCCGCCGCCGGCGGGCGGG + Intronic
964819598 3:160755633-160755655 CTGAGCCGCAGGCGGCCGGCTGG - Intronic
965475444 3:169149557-169149579 CTGTGTTGCCGGCGCCTGGCGGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968225436 3:196969519-196969541 CGGGGTCGGCGACGGCGCGCGGG + Intergenic
968479138 4:826170-826192 CTCGGACGCGGGCGGGGGGCGGG - Exonic
968479166 4:826226-826248 CGGGGCCGCGGGCGCCGGGCGGG + Intergenic
968515137 4:1012542-1012564 CTCGGGCGGCGGCGGCCGGCGGG - Exonic
968552285 4:1229836-1229858 CTAGGTCCCCTGCGGTGGGCAGG - Intronic
968571807 4:1346281-1346303 GGGGGCCGCCGGCGGCGGGCCGG - Intergenic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968903997 4:3443433-3443455 TTGGGTAGCCTGGGGCGGGCAGG + Intronic
969116124 4:4871781-4871803 CTGGGTCGCAGGAGCCGCGCAGG - Intergenic
970333053 4:15003854-15003876 CTGGGTCGGCGGCGGCTGCTGGG - Exonic
971019071 4:22516107-22516129 GGCGGCCGCCGGCGGCGGGCGGG - Intergenic
973292366 4:48483406-48483428 CGGCGTCGGGGGCGGCGGGCCGG - Exonic
978366628 4:107989802-107989824 CGGGGACGCCGGGGGCGCGCGGG + Exonic
983537888 4:168877863-168877885 CGGGGACGCGGGCGGCGTGCAGG - Intronic
983923467 4:173371340-173371362 CTGGGCCCCCGGGGGCGGCCGGG + Exonic
984680918 4:182608631-182608653 CAGGGTCCGCGGCGGCGGGGAGG + Intronic
984860127 4:184230447-184230469 CTGGCTGGCCGGGGGCTGGCAGG - Intergenic
985537398 5:472947-472969 CTGTGACGCCGCCGGCGGGAAGG - Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
992067463 5:73120720-73120742 CTGCGCCGGCGGCGGCGGGTCGG + Intronic
995047866 5:107670950-107670972 CTCGGGCGGCGGCGGCAGGCCGG + Intergenic
997976682 5:138445318-138445340 CTGGGTCGGAGGCGGCCGTCAGG - Exonic
1001065085 5:168529615-168529637 CGGGGGCGACGGCGGCGGCCAGG + Exonic
1002311723 5:178319086-178319108 CTGGGTGGCCAGCGGTGGGTGGG + Intronic
1002621944 5:180494343-180494365 TTGGAGCGCCGGCGGCGGTCCGG + Intergenic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1003698367 6:8435592-8435614 CTGTGTGGCCGGTGGCGGGCGGG + Intergenic
1004396284 6:15248649-15248671 CTGGGGCGCCGGCGCGCGGCGGG - Intronic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1010083102 6:71886722-71886744 CTCGGCCGGCGGGGGCGGGCAGG - Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1012450692 6:99349951-99349973 CTGGAGCGCAGGCGGAGGGCCGG - Intronic
1013170790 6:107634941-107634963 CTGGGTCGCCGGCGGCGGGCGGG - Exonic
1015328404 6:131950638-131950660 CTGGGCTGCAGGGGGCGGGCTGG + Intronic
1018613056 6:165662158-165662180 CCGGGGCGGCGGCGGCGGCCGGG + Intronic
1018694801 6:166382955-166382977 CTGGCTCGCCGTCGGCTGCCGGG - Exonic
1019230307 6:170554715-170554737 CTGGCTGGGCGGCGGCAGGCGGG + Intronic
1019531273 7:1504558-1504580 GTGGGTCGGCGGCGCGGGGCAGG + Intergenic
1020198251 7:6059078-6059100 CTGCATCGCCGGCCGCGCGCGGG + Exonic
1021934869 7:25620358-25620380 CTGGGTGGCTGGCTGTGGGCTGG + Intergenic
1022112990 7:27242950-27242972 CTGGGTCTCCAGCGGCCGGACGG - Exonic
1022207609 7:28179785-28179807 CGGGGCCGGCGGCCGCGGGCGGG - Intronic
1023373500 7:39534280-39534302 CTGGGCCGCCTGCGGCCCGCGGG + Intergenic
1024580056 7:50793648-50793670 CGGGGGCGCGGGCCGCGGGCCGG + Intergenic
1025829865 7:65038929-65038951 CTGGTTCTCGGGAGGCGGGCCGG + Intergenic
1025917118 7:65873929-65873951 CTGGTTCTCGGGAGGCGGGCCGG + Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1028796344 7:94907915-94907937 CGGGGCCGCCCGCCGCGGGCAGG + Intronic
1030033277 7:105388384-105388406 CCGGGTCGCCACCGGCCGGCGGG - Intronic
1031051867 7:116953406-116953428 CCGCGTCCCCGGCGGCGGGCGGG + Exonic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034578930 7:152025936-152025958 CTGCGGCGGCGGCGGCGCGCGGG + Intronic
1034890660 7:154836162-154836184 CCGGGCGGCAGGCGGCGGGCAGG - Intronic
1035082992 7:156233165-156233187 GTCTGTCGCGGGCGGCGGGCGGG + Intergenic
1039936666 8:42051857-42051879 CTGGGCGGCCGGGGGCGGCCGGG + Intronic
1041689758 8:60678226-60678248 CTGCGCGGCCGGCGGCGGCCGGG - Intergenic
1042059088 8:64798403-64798425 CTGGGTCGCGCGCGGCCCGCGGG + Intronic
1045277483 8:100721320-100721342 CTCGGGCGGCGGCGGCGGGCGGG - Intronic
1049046847 8:140159134-140159156 CAGGCTTGGCGGCGGCGGGCGGG - Intronic
1049548872 8:143247157-143247179 CTGGGCCGGAGGCGGCAGGCAGG - Exonic
1049654029 8:143789881-143789903 ATGGGGCGCCGGCTGGGGGCTGG + Intergenic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049998383 9:1051723-1051745 CCCGTCCGCCGGCGGCGGGCTGG - Exonic
1051419062 9:16871810-16871832 CTGGGCCGCGGGCCTCGGGCTGG + Intergenic
1053188279 9:36037202-36037224 CGGGGTCGCCGGACGTGGGCAGG - Intronic
1053435177 9:38069329-38069351 CTGGGTCTGCGGGAGCGGGCGGG - Intergenic
1056825376 9:89873244-89873266 CTGGGTCAGCGCAGGCGGGCAGG - Intergenic
1057772833 9:97983406-97983428 CTGGGTGGCGGGCGGCGTGCGGG - Exonic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061242740 9:129383850-129383872 CGGGGTCGCCGGTCGCGCGCGGG - Intergenic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061728355 9:132594027-132594049 GTGGGTCGGGGGCGGGGGGCGGG + Exonic
1061872151 9:133526893-133526915 CTTGGGGGCCGGCGGGGGGCGGG - Intronic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062084902 9:134643388-134643410 CTTGCTGGCAGGCGGCGGGCTGG - Intronic
1062363747 9:136199250-136199272 AGGGGGCGCCGGCGGAGGGCGGG + Intronic
1062397908 9:136359921-136359943 CTGGGTGGGCGGCAGCAGGCTGG - Intronic
1203769044 EBV:39998-40020 CTGGATTGCCGGCTGGGGGCTGG + Intergenic
1186407022 X:9313208-9313230 CTGGGTCTCAGGAGGTGGGCAGG - Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1192033991 X:67544453-67544475 CTGGGCCGACGGGGGCGGGGGGG - Intronic
1200235535 X:154466182-154466204 CACGGGCCCCGGCGGCGGGCTGG - Exonic