ID: 1013174430

View in Genome Browser
Species Human (GRCh38)
Location 6:107665223-107665245
Sequence CCTTGCATTCAGGAGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174430_1013174438 14 Left 1013174430 6:107665223-107665245 CCTTGGAGCTCCTGAATGCAAGG No data
Right 1013174438 6:107665260-107665282 TCTTTGCCTTCTGCATGGACAGG No data
1013174430_1013174439 17 Left 1013174430 6:107665223-107665245 CCTTGGAGCTCCTGAATGCAAGG No data
Right 1013174439 6:107665263-107665285 TTGCCTTCTGCATGGACAGGCGG No data
1013174430_1013174437 9 Left 1013174430 6:107665223-107665245 CCTTGGAGCTCCTGAATGCAAGG No data
Right 1013174437 6:107665255-107665277 AGGCATCTTTGCCTTCTGCATGG No data
1013174430_1013174441 27 Left 1013174430 6:107665223-107665245 CCTTGGAGCTCCTGAATGCAAGG No data
Right 1013174441 6:107665273-107665295 CATGGACAGGCGGAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174430 Original CRISPR CCTTGCATTCAGGAGCTCCA AGG (reversed) Intergenic
No off target data available for this crispr