ID: 1013174676

View in Genome Browser
Species Human (GRCh38)
Location 6:107667346-107667368
Sequence GTCACTGCCATTGGCCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174676_1013174686 12 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174686 6:107667381-107667403 GGCCGTCAAGGACTGATCCTCGG No data
1013174676_1013174681 -9 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174681 6:107667360-107667382 GGCAGTGACCCTGTGGGCCTGGG No data
1013174676_1013174691 25 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174691 6:107667394-107667416 TGATCCTCGGGGCTGCCCCAGGG No data
1013174676_1013174690 24 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174690 6:107667393-107667415 CTGATCCTCGGGGCTGCCCCAGG No data
1013174676_1013174684 0 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174684 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data
1013174676_1013174692 26 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174692 6:107667395-107667417 GATCCTCGGGGCTGCCCCAGGGG No data
1013174676_1013174689 14 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174689 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
1013174676_1013174680 -10 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174680 6:107667359-107667381 TGGCAGTGACCCTGTGGGCCTGG No data
1013174676_1013174687 13 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174676 Original CRISPR GTCACTGCCATTGGCCACTT AGG (reversed) Intergenic