ID: 1013174679

View in Genome Browser
Species Human (GRCh38)
Location 6:107667355-107667377
Sequence GCCCACAGGGTCACTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174679_1013174687 4 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data
1013174679_1013174694 26 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174679_1013174695 29 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174695 6:107667407-107667429 TGCCCCAGGGGATGCAGTGGAGG No data
1013174679_1013174690 15 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174690 6:107667393-107667415 CTGATCCTCGGGGCTGCCCCAGG No data
1013174679_1013174689 5 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174689 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
1013174679_1013174692 17 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174692 6:107667395-107667417 GATCCTCGGGGCTGCCCCAGGGG No data
1013174679_1013174686 3 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174686 6:107667381-107667403 GGCCGTCAAGGACTGATCCTCGG No data
1013174679_1013174691 16 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174691 6:107667394-107667416 TGATCCTCGGGGCTGCCCCAGGG No data
1013174679_1013174684 -9 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174684 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174679 Original CRISPR GCCCACAGGGTCACTGCCAT TGG (reversed) Intergenic