ID: 1013174682

View in Genome Browser
Species Human (GRCh38)
Location 6:107667368-107667390
Sequence CTTGACGGCCCAGGCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174682_1013174689 -8 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174689 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
1013174682_1013174700 20 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174700 6:107667411-107667433 CCAGGGGATGCAGTGGAGGTGGG No data
1013174682_1013174686 -10 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174686 6:107667381-107667403 GGCCGTCAAGGACTGATCCTCGG No data
1013174682_1013174702 27 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174682_1013174687 -9 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data
1013174682_1013174698 19 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data
1013174682_1013174701 26 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174701 6:107667417-107667439 GATGCAGTGGAGGTGGGTGTCGG No data
1013174682_1013174691 3 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174691 6:107667394-107667416 TGATCCTCGGGGCTGCCCCAGGG No data
1013174682_1013174703 28 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174703 6:107667419-107667441 TGCAGTGGAGGTGGGTGTCGGGG No data
1013174682_1013174694 13 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174682_1013174690 2 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174690 6:107667393-107667415 CTGATCCTCGGGGCTGCCCCAGG No data
1013174682_1013174692 4 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174692 6:107667395-107667417 GATCCTCGGGGCTGCCCCAGGGG No data
1013174682_1013174695 16 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174695 6:107667407-107667429 TGCCCCAGGGGATGCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174682 Original CRISPR CTTGACGGCCCAGGCCCACA GGG (reversed) Intergenic