ID: 1013174685

View in Genome Browser
Species Human (GRCh38)
Location 6:107667377-107667399
Sequence GGATCAGTCCTTGACGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174685_1013174702 18 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174685_1013174704 22 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174704 6:107667422-107667444 AGTGGAGGTGGGTGTCGGGGAGG No data
1013174685_1013174703 19 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174703 6:107667419-107667441 TGCAGTGGAGGTGGGTGTCGGGG No data
1013174685_1013174698 10 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data
1013174685_1013174695 7 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174695 6:107667407-107667429 TGCCCCAGGGGATGCAGTGGAGG No data
1013174685_1013174690 -7 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174690 6:107667393-107667415 CTGATCCTCGGGGCTGCCCCAGG No data
1013174685_1013174701 17 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174701 6:107667417-107667439 GATGCAGTGGAGGTGGGTGTCGG No data
1013174685_1013174691 -6 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174691 6:107667394-107667416 TGATCCTCGGGGCTGCCCCAGGG No data
1013174685_1013174700 11 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174700 6:107667411-107667433 CCAGGGGATGCAGTGGAGGTGGG No data
1013174685_1013174694 4 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174685_1013174692 -5 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174692 6:107667395-107667417 GATCCTCGGGGCTGCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174685 Original CRISPR GGATCAGTCCTTGACGGCCC AGG (reversed) Intergenic