ID: 1013174686 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:107667381-107667403 |
Sequence | GGCCGTCAAGGACTGATCCT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013174676_1013174686 | 12 | Left | 1013174676 | 6:107667346-107667368 | CCTAAGTGGCCAATGGCAGTGAC | No data | ||
Right | 1013174686 | 6:107667381-107667403 | GGCCGTCAAGGACTGATCCTCGG | No data | ||||
1013174682_1013174686 | -10 | Left | 1013174682 | 6:107667368-107667390 | CCCTGTGGGCCTGGGCCGTCAAG | No data | ||
Right | 1013174686 | 6:107667381-107667403 | GGCCGTCAAGGACTGATCCTCGG | No data | ||||
1013174679_1013174686 | 3 | Left | 1013174679 | 6:107667355-107667377 | CCAATGGCAGTGACCCTGTGGGC | No data | ||
Right | 1013174686 | 6:107667381-107667403 | GGCCGTCAAGGACTGATCCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013174686 | Original CRISPR | GGCCGTCAAGGACTGATCCT CGG | Intergenic | ||