ID: 1013174687

View in Genome Browser
Species Human (GRCh38)
Location 6:107667382-107667404
Sequence GCCGTCAAGGACTGATCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174676_1013174687 13 Left 1013174676 6:107667346-107667368 CCTAAGTGGCCAATGGCAGTGAC No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data
1013174682_1013174687 -9 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data
1013174683_1013174687 -10 Left 1013174683 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data
1013174679_1013174687 4 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174687 6:107667382-107667404 GCCGTCAAGGACTGATCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174687 Original CRISPR GCCGTCAAGGACTGATCCTC GGG Intergenic