ID: 1013174694

View in Genome Browser
Species Human (GRCh38)
Location 6:107667404-107667426
Sequence GGCTGCCCCAGGGGATGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174679_1013174694 26 Left 1013174679 6:107667355-107667377 CCAATGGCAGTGACCCTGTGGGC No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174688_1013174694 -2 Left 1013174688 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174683_1013174694 12 Left 1013174683 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174685_1013174694 4 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data
1013174682_1013174694 13 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174694 6:107667404-107667426 GGCTGCCCCAGGGGATGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174694 Original CRISPR GGCTGCCCCAGGGGATGCAG TGG Intergenic