ID: 1013174698

View in Genome Browser
Species Human (GRCh38)
Location 6:107667410-107667432
Sequence CCCAGGGGATGCAGTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174685_1013174698 10 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data
1013174683_1013174698 18 Left 1013174683 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data
1013174682_1013174698 19 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data
1013174688_1013174698 4 Left 1013174688 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
Right 1013174698 6:107667410-107667432 CCCAGGGGATGCAGTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174698 Original CRISPR CCCAGGGGATGCAGTGGAGG TGG Intergenic