ID: 1013174702

View in Genome Browser
Species Human (GRCh38)
Location 6:107667418-107667440
Sequence ATGCAGTGGAGGTGGGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013174683_1013174702 26 Left 1013174683 6:107667369-107667391 CCTGTGGGCCTGGGCCGTCAAGG No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174693_1013174702 -3 Left 1013174693 6:107667398-107667420 CCTCGGGGCTGCCCCAGGGGATG No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174682_1013174702 27 Left 1013174682 6:107667368-107667390 CCCTGTGGGCCTGGGCCGTCAAG No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174688_1013174702 12 Left 1013174688 6:107667383-107667405 CCGTCAAGGACTGATCCTCGGGG No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data
1013174685_1013174702 18 Left 1013174685 6:107667377-107667399 CCTGGGCCGTCAAGGACTGATCC No data
Right 1013174702 6:107667418-107667440 ATGCAGTGGAGGTGGGTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013174702 Original CRISPR ATGCAGTGGAGGTGGGTGTC GGG Intergenic