ID: 1013175859

View in Genome Browser
Species Human (GRCh38)
Location 6:107675827-107675849
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013175857_1013175859 -8 Left 1013175857 6:107675812-107675834 CCACACAAAGCAATGATGTAGGA No data
Right 1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013175859 Original CRISPR ATGTAGGAGGTGTATGAAGA CGG Intergenic
No off target data available for this crispr