ID: 1013177358

View in Genome Browser
Species Human (GRCh38)
Location 6:107689291-107689313
Sequence TGGAGCAGTTCTAGATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013177354_1013177358 26 Left 1013177354 6:107689242-107689264 CCTTTCTTCAAACACAATCATAC No data
Right 1013177358 6:107689291-107689313 TGGAGCAGTTCTAGATGAGAGGG No data
1013177355_1013177358 0 Left 1013177355 6:107689268-107689290 CCAACATATGAAGTAGATCAAAG No data
Right 1013177358 6:107689291-107689313 TGGAGCAGTTCTAGATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013177358 Original CRISPR TGGAGCAGTTCTAGATGAGA GGG Intergenic