ID: 1013180345

View in Genome Browser
Species Human (GRCh38)
Location 6:107712070-107712092
Sequence AGTGTGGATCGGCATTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013180345_1013180349 25 Left 1013180345 6:107712070-107712092 CCATCTGAATGCCGATCCACACT No data
Right 1013180349 6:107712118-107712140 AAAGACATCTGCACTCAACATGG No data
1013180345_1013180350 26 Left 1013180345 6:107712070-107712092 CCATCTGAATGCCGATCCACACT No data
Right 1013180350 6:107712119-107712141 AAGACATCTGCACTCAACATGGG 0: 1
1: 0
2: 2
3: 84
4: 592
1013180345_1013180351 27 Left 1013180345 6:107712070-107712092 CCATCTGAATGCCGATCCACACT No data
Right 1013180351 6:107712120-107712142 AGACATCTGCACTCAACATGGGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013180345 Original CRISPR AGTGTGGATCGGCATTCAGA TGG (reversed) Intronic