ID: 1013185917

View in Genome Browser
Species Human (GRCh38)
Location 6:107757920-107757942
Sequence CTGCGAGGTGTGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013185917_1013185924 21 Left 1013185917 6:107757920-107757942 CCCTTTTTCCTCACACCTCGCAG 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1013185924 6:107757964-107757986 GCTTCCAATCCATCTTGAAATGG 0: 1
1: 0
2: 0
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013185917 Original CRISPR CTGCGAGGTGTGAGGAAAAA GGG (reversed) Intronic
900338144 1:2174997-2175019 TTGTTAGGTGTGAGTAAAAACGG - Intronic
900520204 1:3101707-3101729 CAGCCAGGGGTGGGGAAAAATGG + Intronic
903009879 1:20322164-20322186 ATGCGTGGAGTGAGGAAAAGAGG + Intronic
903862063 1:26370583-26370605 TTGGGAGGAGTGAGGAAAGAGGG - Intronic
905774977 1:40662601-40662623 CCGGGAGGAGTGAAGAAAAAAGG - Intronic
905908250 1:41634008-41634030 CTCCGAGCTTGGAGGAAAAAGGG + Intronic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
907740081 1:57156849-57156871 CTTCGAGGTCTGTGGAAAATGGG - Intronic
907763409 1:57384722-57384744 CTGGGAGGTGGAGGGAAAAATGG + Intronic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
909634165 1:77796699-77796721 CTGAAAGGTGTGAGGAAGAAAGG - Intronic
909642504 1:77884217-77884239 ATGTGAGGTGTGAGGAAAGGAGG - Intergenic
915775486 1:158480348-158480370 CTGGCAGGTGTGTGGAAAACTGG + Exonic
916990068 1:170233514-170233536 CTCCTAGGTATGAGGAACAATGG - Intergenic
917721189 1:177787994-177788016 CTGCCAAGTGTGAAGAACAAGGG + Intergenic
919574300 1:199287831-199287853 CTGCCAGCTGTAAGGAAGAAGGG - Intergenic
920003191 1:202813101-202813123 CTGCCAGGAAAGAGGAAAAAGGG - Intergenic
921057084 1:211550810-211550832 TTGTGATGTGTGAGGAAAAGTGG + Intergenic
922671158 1:227509615-227509637 CTCCGATGTGTCAGGGAAAACGG + Intergenic
923171529 1:231421807-231421829 CTGCGAGCTGTGCGGGAAGATGG - Exonic
924245109 1:242076176-242076198 CTGCAAGGTGTCCCGAAAAATGG + Intergenic
1063095350 10:2903939-2903961 CTAAGAGGTGTAAAGAAAAAAGG - Intergenic
1063958330 10:11285223-11285245 CTGAGGGATGTGAGGACAAAAGG - Intronic
1065365896 10:24936695-24936717 TTGCCAAGTGTGAGGAAACAAGG - Intronic
1067025306 10:42838813-42838835 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1067785613 10:49243438-49243460 CTGCAAGGAGTGTGGAAGAAAGG + Intergenic
1069868190 10:71517118-71517140 TTGGGCGGTGTGAGGACAAAAGG + Intronic
1072603777 10:96959328-96959350 CTGGAAAATGTGAGGAAAAACGG - Intronic
1075339342 10:121633047-121633069 CTGGGAGGGGTGAAGAAGAATGG + Intergenic
1075445660 10:122510972-122510994 CTACGAGGTGTAGGGAAAGATGG + Intronic
1075778786 10:125003950-125003972 CTGCGCTGGGTGAGGAGAAATGG + Intronic
1080101252 11:28462337-28462359 CTAGGAGGTGTGAGTAAAAGAGG + Intergenic
1080302710 11:30801958-30801980 CTGGGAGTTGTGAGGGAACAAGG - Intergenic
1082272002 11:50182626-50182648 GTGGGAGGTGTGAGGAAGGAGGG - Intergenic
1082805869 11:57449891-57449913 CTCCAGGGTGTGGGGAAAAAAGG - Intergenic
1083461010 11:62811885-62811907 CTGCTGGGTCTGAGGATAAAAGG - Intronic
1083464349 11:62835212-62835234 CTTCCAGGTGGGAGGAAAACAGG + Intronic
1083562260 11:63681971-63681993 TAGCGGGGTGTGAGGAAAACAGG + Intronic
1084216557 11:67650066-67650088 CTGTGGGGAGTGAGGAACAAAGG + Intronic
1084780366 11:71404277-71404299 TGGCGAGGTGTGAGGAAGAGAGG - Intergenic
1085265220 11:75233881-75233903 CTGCCAGTTGTGAGGCAACAGGG + Intergenic
1086244775 11:84739700-84739722 CTGGCAGATGTGAGGAAAAATGG - Intronic
1087788182 11:102379105-102379127 TTGTGAGGTGAGAAGAAAAATGG - Intergenic
1090001015 11:122958357-122958379 CTTCAAGGTCTGAGGAAGAAAGG - Intronic
1090659124 11:128869415-128869437 CTGTGAAGTGTGAGGAACAGTGG - Intergenic
1091683623 12:2545125-2545147 TTGTGATGTGTGAGGAAAAGTGG - Intronic
1092146842 12:6220510-6220532 CTGCGAGGTTGAAGAAAAAAAGG + Intronic
1095239462 12:39839621-39839643 CTGAGAGGTGGGAGAAACAAAGG - Intronic
1095545468 12:43363106-43363128 ATGGGAGGTGGGAGGAAAAGAGG - Intronic
1096420760 12:51455415-51455437 CTGGAAGTTGTGTGGAAAAAAGG + Intronic
1097052172 12:56230217-56230239 CTGCGGGGGGAGAGGAAACAAGG - Intronic
1098504494 12:71233415-71233437 CATCCAGGTGTGAGGGAAAAGGG + Intronic
1101306983 12:103538246-103538268 CTGCTAGCTGGGAAGAAAAATGG + Intergenic
1101372950 12:104146515-104146537 CTGCAAAGTGTGAGAAAACAAGG - Intergenic
1102968036 12:117143362-117143384 CTACTATGTGGGAGGAAAAAAGG - Intronic
1103728779 12:123012520-123012542 CTACCAGGTGTGGGGAAAAGGGG + Intronic
1105882128 13:24614474-24614496 CTGAGAGGTGTGATGGAAGATGG - Intergenic
1106470922 13:30053378-30053400 AAGTGAGGTGTGAGAAAAAAGGG - Intergenic
1107675992 13:42797220-42797242 CTGCGAAGGGTGAGGATTAAGGG + Intergenic
1107881493 13:44835922-44835944 TTGCGAGGTGTGATGAAAAGTGG - Intergenic
1108422956 13:50269190-50269212 CTGTGAGCTGAGGGGAAAAAGGG - Intronic
1109594297 13:64530057-64530079 CTGGGGGGTGGGAGGAAAACAGG - Intergenic
1109811915 13:67524591-67524613 CTCCCAGGTATAAGGAAAAAGGG - Intergenic
1109869513 13:68315155-68315177 ATGCAAGGTGTGAGAAAGAAAGG + Intergenic
1110146313 13:72194894-72194916 CTGCAAGGTTTGAGGAAGACGGG + Intergenic
1113600734 13:111566536-111566558 CTGGGAAGTGTGTGGAGAAAAGG - Intergenic
1114552650 14:23542273-23542295 GGGTGAGGTGTGAGGAGAAAAGG + Intronic
1114915221 14:27255494-27255516 CTGGGAGGTGTCAGGGAAATGGG + Intergenic
1115277808 14:31627161-31627183 CTGAAATGTGGGAGGAAAAAAGG + Intronic
1115871878 14:37813792-37813814 ATGTGGGGTGTGAGGAAAGAGGG - Intronic
1118117156 14:62792685-62792707 CTGTGAAGTGTGAGAAATAATGG + Intronic
1118906689 14:70028597-70028619 CTGAGATGTGTGAAGCAAAATGG - Intronic
1118971815 14:70643257-70643279 CTGCTAGGGGTGAAGGAAAAGGG + Intronic
1121300087 14:92863084-92863106 CTGTGAGGGGTGAGGATAAAAGG - Intergenic
1121475015 14:94191209-94191231 CTGTGGGGTGTGAGGAGAAAGGG + Intronic
1121568642 14:94929897-94929919 CTGGGAGCTGTGAGGGAAAAGGG - Intergenic
1123425933 15:20170267-20170289 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1123535165 15:21176791-21176813 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1125180795 15:36879615-36879637 CTGAGAGAGGTGAGGAGAAAGGG + Intergenic
1127025423 15:54799952-54799974 CTGCAATTTGTGGGGAAAAAAGG - Intergenic
1127996123 15:64153919-64153941 CTGGGAGCTGGGAGGAAACAGGG - Exonic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129325785 15:74799620-74799642 CACCAAGGTGTGAGGAAACAAGG - Intronic
1130517116 15:84633933-84633955 CTGCGAGCTGTGCGGGAAGATGG + Intergenic
1131093885 15:89643988-89644010 CTGGGAGGTGTAGGGAAGAAAGG + Intronic
1135755870 16:25097568-25097590 ATGCGATGTGCCAGGAAAAATGG - Intergenic
1136858319 16:33679251-33679273 CTGGGGGTTGTGAGGAACAAGGG - Intergenic
1137353505 16:47735320-47735342 CTCTGAGGTGAGAGCAAAAAAGG + Intergenic
1137782238 16:51107512-51107534 CTGAGAGGTGTGAGGGACACAGG - Intergenic
1140483684 16:75277353-75277375 CTGAGAGGTGAGAGGATAGAGGG + Intergenic
1142074574 16:88110064-88110086 ATGTGAGGAGTGAGGGAAAAAGG - Intronic
1143473973 17:7192596-7192618 CAGCGGGGAGTCAGGAAAAAGGG + Intronic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1147489088 17:40847171-40847193 ATGAGTGGTGTTAGGAAAAATGG + Intergenic
1149491552 17:57088453-57088475 CTCAGAGGTGTGAGGATTAAAGG - Intronic
1150550706 17:66207227-66207249 CTGAGAGGTGAGAAGAAAGATGG + Intergenic
1153859326 18:9184957-9184979 CTGAGTGATGGGAGGAAAAAAGG + Intronic
1154172814 18:12063371-12063393 ATTGGAGGTGTGAGGACAAATGG + Intergenic
1154980872 18:21501207-21501229 CTGCGAGGTGCTGGGCAAAAAGG + Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1156060873 18:33074623-33074645 CAGTGAGGTGGGAGGAAAATAGG + Intronic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1160244962 18:77150486-77150508 CTGAGAGCTGTGAGGAAAAGGGG - Intergenic
1161986787 19:7659738-7659760 CAGGGAGGGGTGAGGAAAAGGGG + Intergenic
1162416521 19:10541469-10541491 CTGGGAGGAGAGGGGAAAAAAGG + Intergenic
1164764975 19:30757404-30757426 CTGCGAGGTCTGATAAGAAAGGG + Intergenic
1168280357 19:55302377-55302399 CTCCCAGGTTTGAGGGAAAAAGG + Intronic
1168356367 19:55702603-55702625 CTGCGTGGTGTGGTGAGAAAGGG + Intronic
926095226 2:10077093-10077115 CTGGGATGTGTGAGAAAGAAAGG - Intronic
929974950 2:46624167-46624189 CTGTGCGATGTGTGGAAAAAAGG + Exonic
930595521 2:53383033-53383055 CTGGGAGGAGAGAGGAAAAAGGG + Intergenic
931665628 2:64608201-64608223 CTGCGAGGTGGGTGGAGGAAAGG - Intergenic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
932331747 2:70901746-70901768 CGGCGAGATGAGAGGAGAAAGGG + Intronic
933529848 2:83494366-83494388 CAGCAAGGTTTGAGGATAAAAGG + Intergenic
934045422 2:88169735-88169757 CAGCAAGGTGTGAAGAAGAAAGG - Intergenic
934759151 2:96843998-96844020 CTGGGGGGTGTGAGGAACAGGGG - Exonic
935231926 2:101106459-101106481 GTGCGAGGAGTGAGGGAAATAGG + Intronic
935832936 2:107019300-107019322 CTGCAACGTGTGAGGATACAGGG - Intergenic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
938784141 2:134610001-134610023 CTGGGTGGGGTGAGGCAAAAGGG + Intronic
940777794 2:157902865-157902887 CTGCGAGGGGGCAGGAGAAAGGG - Intronic
942315415 2:174692824-174692846 CTGCGTGGTGGCAGGCAAAATGG + Intergenic
943455418 2:188101634-188101656 TTGAGAGGTGTGAAGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
943793871 2:191967636-191967658 CTGCGAGAGGTAAGAAAAAATGG - Intronic
945178318 2:207065882-207065904 TTGCCAGGTGTGAGGCAACATGG - Intergenic
945516995 2:210774838-210774860 AAGAGAGGTGGGAGGAAAAATGG + Intergenic
946866854 2:224048700-224048722 CTCAGAGGTGAGAGGAAAGAAGG - Intergenic
948863334 2:240763411-240763433 CGGGGAGGCGTGAGGAGAAAGGG + Intronic
1170612645 20:17927315-17927337 GTGGAAGGTTTGAGGAAAAAAGG + Intergenic
1171427952 20:25060144-25060166 CTGCGAGCTGTGAGGAAGCGGGG + Intergenic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1173546001 20:43898432-43898454 CTGGGAGGTAGGAGGAAAACAGG + Intergenic
1175469649 20:59218394-59218416 CTTTGAGGTGTGAGGAAAAGAGG + Intronic
1177412036 21:20741593-20741615 CTCCGAGTTATGAGGAAACATGG + Intergenic
1179263358 21:39778439-39778461 CATGGAGGTGGGAGGAAAAAAGG - Intronic
1182312630 22:29420087-29420109 CTTAGAGGTTTGAGGAAAACAGG - Intronic
949186191 3:1194815-1194837 CTGCCAGGTAGCAGGAAAAAAGG - Intronic
949466584 3:4350850-4350872 CTAGGAGGTATGAGCAAAAAGGG - Intronic
951137087 3:19117333-19117355 CTGCTAGGTTTGAGAAAAACAGG - Intergenic
952145204 3:30524925-30524947 CAGGGAGGTGTGAGCAAAAGAGG + Intergenic
952146441 3:30537866-30537888 CTGCAAGGGGTAAGGAACAAAGG + Intergenic
952962033 3:38598379-38598401 CTGGGATGTGTCAGGACAAATGG + Intronic
954837216 3:53480508-53480530 CTGGGAGATTAGAGGAAAAAGGG + Intergenic
960493068 3:118340934-118340956 CTGTGAGAAGTGGGGAAAAAAGG + Intergenic
963941865 3:151103874-151103896 CTGAGAGGTGAGAAGTAAAATGG - Intronic
968425945 4:523333-523355 GTGCTGGGTGTGAGGAACAATGG + Intronic
970132294 4:12885122-12885144 CTTGCAGGTGTGAGGAAGAAAGG - Intergenic
971405947 4:26320926-26320948 AATCGAGGAGTGAGGAAAAAGGG + Intronic
971710929 4:30111631-30111653 CTGCCAAGAGTGTGGAAAAATGG + Intergenic
978151188 4:105437289-105437311 CTTCTAGGAGTGAGAAAAAAGGG + Intronic
980085037 4:128382232-128382254 CAGAGAGGTGTGAGAAAACAGGG - Intergenic
981491145 4:145340661-145340683 CTTTGAAGGGTGAGGAAAAATGG - Intergenic
982722769 4:158876461-158876483 CAGAGAGGTGTGAGGAAAGGTGG - Intronic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
986013922 5:3740924-3740946 CAGTGAGGTGTGAGGAAAGCCGG - Intergenic
987109050 5:14667729-14667751 CTGCTGGGTGTATGGAAAAAAGG - Intronic
988957749 5:36336035-36336057 CTGGAAGGTGTTAGGACAAATGG - Intergenic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
991954408 5:71978130-71978152 CAGAGAGGTGTGTGGAGAAATGG + Intergenic
995886114 5:116895815-116895837 ATGCTAGGTTTGATGAAAAATGG + Intergenic
996191511 5:120549059-120549081 CTTGGAGGTATGAGGAAAACAGG - Intronic
998341585 5:141422579-141422601 GTAAGAGGAGTGAGGAAAAACGG - Exonic
999232580 5:150070294-150070316 CTGGGGGGTCTGAGGAAGAAAGG + Exonic
999344596 5:150804919-150804941 GTGGGGGGAGTGAGGAAAAAAGG + Intergenic
999791632 5:154945283-154945305 ATGGGAGGTGTGAGAAAGAAGGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004538416 6:16525101-16525123 TTGTGAGGGGTGAGGAAAAAGGG - Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1006939167 6:37740259-37740281 CTGAGAACTGTGAGGAAGAAAGG - Intergenic
1006944733 6:37777796-37777818 CTGGGAGGGGAGAGGAAAACTGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009039747 6:58162094-58162116 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1009215642 6:60916940-60916962 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1011227584 6:85124825-85124847 CTGGGAGGTGTGGGTAAGAAGGG + Intergenic
1012657410 6:101841914-101841936 CTGCGAGTTGAATGGAAAAATGG + Intronic
1012836793 6:104279765-104279787 ATGTGAGATGTGAGGGAAAAAGG - Intergenic
1013185917 6:107757920-107757942 CTGCGAGGTGTGAGGAAAAAGGG - Intronic
1019127685 6:169851871-169851893 CTGTGACCTGTGAGGCAAAAGGG - Intergenic
1021770829 7:23999359-23999381 GTGGGAAGAGTGAGGAAAAAGGG - Intergenic
1023711633 7:42999674-42999696 CTGAGAGAGGTGAGGAAGAAGGG - Intergenic
1026508515 7:71007378-71007400 CTGGGTGATGTGAGGAGAAATGG + Intergenic
1026852887 7:73735870-73735892 CTGGGAGGTGTGGGGAAAGAGGG + Intergenic
1033550352 7:142441374-142441396 CTGGGAGCTGTGAGGAAAAGAGG - Intergenic
1033851579 7:145502593-145502615 CTGGGATATGTGAGGCAAAAGGG + Intergenic
1035736164 8:1889017-1889039 GTGAGAGTTGTGAGGAAACATGG + Intronic
1035907937 8:3534329-3534351 CTGAGAGGAGTGTGGAAAACAGG - Intronic
1035909951 8:3555182-3555204 CTGGGAGGTGTAGGGAAAGATGG + Intronic
1036412318 8:8513614-8513636 CTGCAGGGTGAGAGGAAAACAGG + Intergenic
1036609043 8:10334072-10334094 CTGCAAGCAGGGAGGAAAAAAGG + Intronic
1037995935 8:23352416-23352438 CTGGGTGGTTTGGGGAAAAAAGG - Intronic
1038914637 8:32007038-32007060 CAGTGGGATGTGAGGAAAAATGG - Intronic
1040775394 8:51037269-51037291 CAGAGAGGTGTGAGGAGAGAAGG - Intergenic
1040884926 8:52251119-52251141 CTGCAGGGTGTGATCAAAAACGG + Intronic
1047032315 8:120896142-120896164 CTCCCAGTTGTGAGAAAAAAGGG - Intergenic
1048571304 8:135659395-135659417 CTGCCAGGTGGAAGGAGAAACGG + Intergenic
1049879052 8:145049600-145049622 CTGAGAGATATGAGGAAAAGAGG - Intergenic
1050132734 9:2429386-2429408 CTGGGAGGTGGAAGGAAATACGG - Intergenic
1051573883 9:18592274-18592296 TTGTGATGTGTGATGAAAAATGG - Intronic
1051955047 9:22682333-22682355 ATGGGAGATGTGAAGAAAAATGG + Intergenic
1053439577 9:38105195-38105217 TGGCCAGGTGTGAGGACAAAAGG - Intergenic
1056738065 9:89226453-89226475 ATGCCCGGTGGGAGGAAAAAGGG - Intergenic
1059562661 9:115350397-115350419 CTTCTGGGTGGGAGGAAAAAGGG + Intronic
1060346552 9:122821983-122822005 CTGCAAGATGGGAGGAAAATTGG - Intronic
1062177796 9:135173847-135173869 CTGCGGGCTGTGAGGGAGAAGGG + Intergenic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1187255535 X:17638543-17638565 CAGCATGGTGTGAGGAAAATGGG + Intronic
1188031187 X:25266040-25266062 CTGTGAGGCCTGAGGCAAAAGGG - Intergenic
1188065257 X:25651268-25651290 TTGGGAGGTGTGAGGAGAGATGG - Intergenic
1189305837 X:39985952-39985974 CTGTAAGGGGTGAGGACAAAAGG + Intergenic
1189615261 X:42776686-42776708 CTGGGAGGACTGAGGAACAAAGG + Intergenic
1191104140 X:56761882-56761904 ATGGGAGGAGAGAGGAAAAACGG - Intergenic
1191863068 X:65681742-65681764 CTGTGAGGTGTGAGGCACAAAGG + Intronic
1194009589 X:88544244-88544266 GTGTGTGGTGTGAAGAAAAAGGG - Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1196046289 X:111259715-111259737 CTGTCAGCTGTGAGGAAAAAAGG - Intronic
1196224167 X:113146039-113146061 CTGGAAAGTGTGAGGAAGAATGG - Intergenic
1198808255 X:140509695-140509717 CTGCGAGGTATGGGAAAACAAGG + Intergenic
1199466461 X:148143359-148143381 CTGGGAGTTGTGATGAAAGAAGG - Intergenic
1199855621 X:151756619-151756641 CTGGGAGCTGGGAGGAAGAAGGG - Intergenic