ID: 1013187177

View in Genome Browser
Species Human (GRCh38)
Location 6:107769816-107769838
Sequence TAGTAGCCTTAGATTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013187177 Original CRISPR TAGTAGCCTTAGATTTGGAG GGG (reversed) Intronic
904388883 1:30166094-30166116 TATCAGCTTTAGATTTGGTGGGG + Intergenic
905959205 1:42029404-42029426 GAGTAGACTGAGGTTTGGAGAGG - Intronic
906562296 1:46768189-46768211 TAGCAACCTGAGATTTAGAGAGG + Intronic
911456604 1:98132142-98132164 TAGTAGCTTTAGAGTTGGAAGGG + Intergenic
913245826 1:116869244-116869266 TAGTAGCTATGGATTTGGAGGGG + Intergenic
916558146 1:165910654-165910676 AAGTATCCTTTGATTTGGAGTGG + Intronic
918414687 1:184294435-184294457 TTCTAGCCTTAGATTTGAGGGGG + Intergenic
1063277084 10:4581534-4581556 AAGTAGCATGAGATTTGGAGAGG - Intergenic
1063710498 10:8472611-8472633 TTTCAGCCTGAGATTTGGAGGGG + Intergenic
1064820291 10:19321989-19322011 TGGTAGCATTAAAATTGGAGAGG + Intronic
1066660243 10:37731376-37731398 CAAGAGCCTTAGATTTTGAGAGG - Intergenic
1068940851 10:62679526-62679548 AAATAGCCTTAGATTGGAAGAGG - Intergenic
1069874522 10:71553445-71553467 CAGTAGCCTCAGGATTGGAGAGG + Intronic
1072314962 10:94193196-94193218 TTTTAGCCTGAGATTTGGATAGG + Intronic
1072352734 10:94573777-94573799 TAGTAGCTTTTCATTTGTAGAGG + Intronic
1073793136 10:106960133-106960155 TAATATCCTAAGATTTAGAGAGG - Intronic
1073962249 10:108945848-108945870 CAGTAGCATTAGATTTGCATGGG - Intergenic
1074166869 10:110887720-110887742 CAGTATCCTTAGCATTGGAGGGG + Exonic
1079352277 11:19701816-19701838 TATTTGCCTTGGATTTGGAGAGG + Intronic
1081718671 11:45269723-45269745 TAGTAGCACTAGCTTTGGGGTGG - Intronic
1083715563 11:64573614-64573636 TCGTAGTCCTAGATTTGTAGTGG - Intergenic
1084937757 11:72596083-72596105 AACTAGCCAGAGATTTGGAGTGG - Intronic
1090291267 11:125547181-125547203 ATTTAGCCTTAGATTTTGAGAGG - Intergenic
1090431344 11:126649271-126649293 TGAGAACCTTAGATTTGGAGGGG - Intronic
1093231091 12:16542872-16542894 TAGTAAACTTAGATTAGGGGTGG + Intronic
1099672047 12:85706577-85706599 TTGTAACATGAGATTTGGAGGGG + Intergenic
1100412115 12:94330193-94330215 TAGTAGCATTTGTTGTGGAGAGG - Intronic
1104421834 12:128642418-128642440 TTGCAGCATGAGATTTGGAGGGG - Intronic
1108890884 13:55257742-55257764 TAGAAGCCTTAGATCATGAGTGG + Intergenic
1110493885 13:76142443-76142465 TAGTAACCTTTGCTTTTGAGGGG + Intergenic
1112344813 13:98580251-98580273 TAGGGGCTTTATATTTGGAGGGG - Intergenic
1117823467 14:59675649-59675671 GAGGAGCCTAAGATTTGGAGAGG + Intronic
1118482382 14:66180230-66180252 GAGTAGCCGTAGAGATGGAGGGG - Intergenic
1125598254 15:40901061-40901083 CAGTAGCTTTAGATGTGGAAGGG + Intronic
1125801163 15:42448645-42448667 AAGAAGCCTTAGATTTGGATGGG - Exonic
1130563767 15:84978584-84978606 TAGTAGTCCTAGATTTACAGTGG + Intergenic
1131664722 15:94558043-94558065 GAGAAGACTTAGATTTAGAGAGG + Intergenic
1132035183 15:98477348-98477370 TTTTAACCTGAGATTTGGAGGGG + Intronic
1133676982 16:8082582-8082604 TATTAACATGAGATTTGGAGGGG - Intergenic
1137464712 16:48697643-48697665 TTTCAGCATTAGATTTGGAGGGG + Intergenic
1146738200 17:35257820-35257842 TTGTAGCCTAATATTGGGAGGGG - Intronic
1149173664 17:53843936-53843958 TAGGAGCCTTAGATTTTGAGAGG + Intergenic
1149318671 17:55462834-55462856 TATGAGCCTCAGATGTGGAGAGG + Intergenic
1152179618 17:78810653-78810675 TAGAAGCATTAGAATTGAAGTGG - Intronic
1155609287 18:27645619-27645641 TAGTAGCTTTTGTTTTGGGGTGG - Intergenic
1159966700 18:74601813-74601835 TTTCAGCCTGAGATTTGGAGGGG + Intronic
1164470281 19:28524402-28524424 AAATAGCCTTTGATTTTGAGAGG - Intergenic
1165301133 19:34969943-34969965 TTGCAACCTGAGATTTGGAGGGG + Intergenic
928278992 2:29927741-29927763 TAATTTACTTAGATTTGGAGGGG - Intergenic
929072042 2:38040755-38040777 TAGTTTACCTAGATTTGGAGTGG + Intronic
936344978 2:111668598-111668620 GTGTAGCCTCAGATTTGCAGTGG - Intergenic
938712103 2:133983775-133983797 TTTTAGCATGAGATTTGGAGGGG + Intergenic
939513802 2:143141127-143141149 TGGCAGCTTTAGATGTGGAGAGG + Intronic
939679848 2:145116947-145116969 AAGTATGCATAGATTTGGAGGGG - Intergenic
940181451 2:150938303-150938325 TAATAGCTTCAAATTTGGAGAGG - Intergenic
940499203 2:154473783-154473805 TATTTGCCTTAGATTTCGAGAGG + Intergenic
943931086 2:193854227-193854249 TGGTACCCTAAGATTTGGAATGG + Intergenic
944331315 2:198469557-198469579 TATCAGCGTAAGATTTGGAGGGG + Intronic
1182925172 22:34115613-34115635 TAGGACCATTATATTTGGAGAGG + Intergenic
1184629410 22:45763926-45763948 TAGCAGCCTTAGATAAGAAGGGG - Intronic
949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG + Intergenic
949814635 3:8045134-8045156 GAATTGCCTTAGATTTGTAGAGG - Intergenic
952284025 3:31950613-31950635 TTTCAGCCTGAGATTTGGAGAGG - Intronic
956710796 3:72036996-72037018 TAATAGCCTCAGATTTGGACAGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
960349889 3:116579014-116579036 CATTAGCCTCAGAGTTGGAGTGG - Intronic
964970238 3:162551383-162551405 GAACAGCCTTAGATTTTGAGAGG + Intergenic
965083133 3:164061699-164061721 TTCTAACCTGAGATTTGGAGAGG + Intergenic
965550300 3:169958241-169958263 TAGTAGCCTTAATTTAGGGGTGG + Intergenic
971268178 4:25112933-25112955 TAGGAGCCTTTGCTTTAGAGCGG - Intergenic
972510418 4:39763685-39763707 TTGCAGCATGAGATTTGGAGAGG + Intronic
973266919 4:48220318-48220340 TTTCAGCATTAGATTTGGAGGGG - Intronic
973724224 4:53756857-53756879 TAGGAGCCTTGACTTTGGAGTGG + Intronic
975066358 4:70069585-70069607 TAGTAGCTCTAGATTTTCAGTGG + Intergenic
978274113 4:106928188-106928210 CAGTAGCCTTATATTTGAATGGG + Intronic
981691007 4:147508972-147508994 TAGTTTCCTTGGATTTGGATAGG + Intronic
982457935 4:155632394-155632416 TAGTAGCATTTCATTTGGAGAGG - Intergenic
983901043 4:173134765-173134787 TAATAGCCTTAGGTTTGATGAGG + Intergenic
990262829 5:54043609-54043631 ATGTAGCCTGACATTTGGAGAGG - Intronic
990878088 5:60509562-60509584 TAGGAGTCTTAGCATTGGAGGGG - Intronic
992248462 5:74853407-74853429 GAGGAGCCTCAGATGTGGAGAGG + Intronic
993294518 5:86119090-86119112 TATTTGCCTTAGATTTTAAGAGG - Intergenic
993878897 5:93340622-93340644 TAATAGCACTAGCTTTGGAGAGG - Intergenic
996637274 5:125708629-125708651 TAGTAGGCTTAGAGTAGTAGCGG + Intergenic
996827170 5:127698046-127698068 TAGTAGCCCTGGAATTTGAGTGG + Intergenic
997926053 5:138032534-138032556 TGGCAGCCTTGGATTTGCAGCGG - Intronic
998324447 5:141267267-141267289 TAGTATCCTTAGAATGGGAATGG + Intergenic
998712625 5:144843995-144844017 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
998730683 5:145072591-145072613 TTTCAGCCTGAGATTTGGAGGGG + Intergenic
1000433071 5:161174302-161174324 TATTAGCATGAGTTTTGGAGAGG + Intergenic
1002172108 5:177380953-177380975 TACAGGCCTGAGATTTGGAGGGG + Intronic
1006290855 6:33135480-33135502 ATTTAGCCTTAGATTTTGAGAGG + Intergenic
1008774437 6:55019291-55019313 TGGTTGCCAGAGATTTGGAGAGG - Intergenic
1009716235 6:67400188-67400210 TACTAGCCTTTGATTTGTATAGG + Intergenic
1010768462 6:79802421-79802443 TAGAAGCCTGAGATCTGGAGTGG - Intergenic
1010878120 6:81134745-81134767 TGGTAGCCCTAGGTTTGGAAAGG - Intergenic
1013187177 6:107769816-107769838 TAGTAGCCTTAGATTTGGAGGGG - Intronic
1017664501 6:156706556-156706578 TAGTAGTTTTATTTTTGGAGGGG + Intergenic
1023532433 7:41172513-41172535 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
1030854488 7:114536307-114536329 TACTGGACTTAGCTTTGGAGAGG - Intronic
1034406485 7:150906543-150906565 TTGTAGCCTGAGTTTTGGTGTGG - Intergenic
1044215423 8:89603884-89603906 GAGAAGCCTGAGATTTGCAGTGG + Intergenic
1046412598 8:113866364-113866386 AAGAAACCTGAGATTTGGAGAGG - Intergenic
1052076848 9:24153367-24153389 TAGTTGCCTTAATCTTGGAGAGG + Intergenic
1053322234 9:37109448-37109470 TAATATCCTTTGATTTGGAAAGG - Intergenic
1053668503 9:40336062-40336084 TTTTAGCATGAGATTTGGAGGGG - Intergenic
1054516108 9:66040231-66040253 TTTTAGCATGAGATTTGGAGGGG + Intergenic
1055276329 9:74621273-74621295 TAGTTGCCATGGGTTTGGAGTGG - Intronic
1057163319 9:92906790-92906812 AAAGAGCCTTAGATTTTGAGAGG + Intergenic
1057645471 9:96870602-96870624 TAGGAGCCTTCACTTTGGAGTGG - Intronic
1058062364 9:100511132-100511154 TAGTAGACTATGATTTGGTGTGG + Intronic
1058824831 9:108765927-108765949 CAGTAGCCTTGGTTTTGGGGTGG + Intergenic
1059682195 9:116597047-116597069 TAATCCCCTTATATTTGGAGAGG - Intronic
1188014170 X:25089609-25089631 TTGCAGCATGAGATTTGGAGGGG + Intergenic
1188802687 X:34551217-34551239 ATTTAGCCTTAGATTTTGAGAGG - Intergenic
1189711443 X:43816794-43816816 CAGTGGCATTGGATTTGGAGTGG + Intronic
1190169682 X:48102134-48102156 TTTCAGCCTGAGATTTGGAGGGG - Intergenic
1191812543 X:65204664-65204686 TGGTAGCCTTACCTTTTGAGAGG + Intergenic
1194414962 X:93600892-93600914 TTATAGCATGAGATTTGGAGAGG - Intergenic
1198046194 X:132905616-132905638 TTATAGCCTGACATTTGGAGGGG + Intronic