ID: 1013188466

View in Genome Browser
Species Human (GRCh38)
Location 6:107782403-107782425
Sequence CACACTCAGCCCCCCGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013188466 Original CRISPR CACACTCAGCCCCCCGGGAC CGG (reversed) Intronic
900164136 1:1237955-1237977 CGGACTCAGGCCCTCGGGACGGG - Intergenic
900190043 1:1349391-1349413 CACGCTCAGGACCCCGGGCCGGG - Intergenic
900390688 1:2432600-2432622 CACACTCAGCGCCCTGGGCCCGG + Intronic
900422334 1:2560998-2561020 CACCCACAGCCCCAGGGGACAGG - Intronic
900458654 1:2789770-2789792 CGCACACAGCCCCCCGGGTGCGG + Intronic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
902053934 1:13584614-13584636 CACACTCAGCACCCCGTCACTGG + Intronic
902376527 1:16032550-16032572 CACACGCAGCCCCCGGGGCAGGG + Intronic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
915837228 1:159187655-159187677 CACACTCAGTCCCTCGGTATTGG - Intronic
922277030 1:224088675-224088697 TACACTCAGCACCTCAGGACAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1065723990 10:28652819-28652841 CACACTCAGCCCATCAGCACTGG - Intergenic
1066239904 10:33523428-33523450 CACCCTCAGCCTTCCGGAACTGG + Intergenic
1067060862 10:43077275-43077297 CAGACGCAGCCCCGCGGCACCGG - Exonic
1067947917 10:50702318-50702340 GACACTCAGCCCCCAGTGCCTGG - Intergenic
1075062188 10:119264924-119264946 GACACTGAGCTCCCAGGGACAGG - Intronic
1075476231 10:122736744-122736766 CACACTGAGCCCCACATGACAGG - Intergenic
1076138054 10:128058469-128058491 CCCACGCAGCTGCCCGGGACTGG + Intronic
1076173227 10:128340666-128340688 CACACTCAGCTCCCAGGTGCTGG + Intergenic
1076593625 10:131609415-131609437 CACGCTCAGCCTCCGGGCACAGG + Intergenic
1076723173 10:132401569-132401591 CACACCCACCCCCTAGGGACAGG - Intronic
1076824543 10:132960448-132960470 CACAATCAGGCCCCCGGGGCAGG + Intergenic
1076893362 10:133296036-133296058 CACACTCAGCATCCCAGGAAAGG - Intronic
1082954700 11:58857476-58857498 CTCACTCATCCCCCTGGGGCGGG + Intronic
1091647277 12:2283473-2283495 CACACTCAGCCTGCAGGGACAGG + Intronic
1096199747 12:49673136-49673158 CACACTCAGCCCATGGGGACAGG + Intronic
1097748926 12:63330834-63330856 CACGCTAAGCCCCCTGGGTCGGG + Intergenic
1105378156 13:19863499-19863521 CACTCTCAGCGGCCCTGGACTGG + Exonic
1106483130 13:30151460-30151482 CACCCTCAGCACCATGGGACAGG + Intergenic
1113566613 13:111323176-111323198 CACACTCACTCATCCGGGACAGG + Intronic
1113868735 13:113545570-113545592 CCCACTCCGCCCCCAGGGCCAGG + Intronic
1113897773 13:113776678-113776700 CACACTCGGCCCCACGTGTCCGG - Intronic
1114557356 14:23569739-23569761 CAGACTCAGTCCCCGAGGACAGG + Intronic
1115923585 14:38406097-38406119 CACAGGCAGCCCCCTGGGAAAGG - Intergenic
1121106153 14:91281296-91281318 CACGCTCAGCCCCCTGGGGAGGG + Intronic
1122048906 14:99042032-99042054 CACGCTCAGCCGTCCGGGACAGG + Intergenic
1122269013 14:100560026-100560048 CCCTCTCAGCCCCCCGCGGCTGG - Intronic
1122659876 14:103288079-103288101 CACACACATCCCCCAGGGCCTGG + Intergenic
1129258332 15:74347325-74347347 CAGCCTCTGCCCCCCGGCACAGG - Intronic
1129784372 15:78299416-78299438 CACCCTCAGGCCCCAGGGCCTGG + Intronic
1131050915 15:89347255-89347277 CTCACCCAGGCCCCAGGGACTGG - Intergenic
1131585179 15:93684909-93684931 CACACTCAGCCCCAGGGGTGAGG - Intergenic
1132518643 16:377426-377448 CCCACCCGGCCCCCGGGGACTGG - Exonic
1133019648 16:2961708-2961730 CCCAGTCAGCCCCCCAGGAAGGG - Intergenic
1133234813 16:4382809-4382831 CACACTCAGACCCGCTGGGCAGG - Exonic
1134291244 16:12903786-12903808 CACACACAGGCCCCCGGCAGAGG - Intronic
1136318910 16:29469856-29469878 CACACTCAGCCACCAGGGCAAGG + Intergenic
1136433482 16:30209200-30209222 CACACTCAGCCACCAGGGCAAGG + Intergenic
1138160059 16:54745096-54745118 CAACCTCAGACCCCCAGGACTGG - Intergenic
1145140120 17:20444247-20444269 CATCCGCAGGCCCCCGGGACAGG + Intergenic
1148648095 17:49230643-49230665 CATCCTCAGTCCCTCGGGACTGG - Exonic
1149443940 17:56699272-56699294 CACACACAGCCCCAAGGGACCGG + Intergenic
1149512655 17:57256321-57256343 CACACTCGGCCCCCCACGGCCGG - Intronic
1150693799 17:67386878-67386900 CAAATTCAGCCCACCGGGAGAGG + Intronic
1152130368 17:78472610-78472632 CACACACAGCCCCCGGGGCCAGG - Intronic
1159823610 18:73177418-73177440 CACACTCAGCCTCACAGAACTGG + Intronic
1160894393 19:1395868-1395890 CACACTCTGAACCCCGGGGCAGG - Intergenic
1162726304 19:12691444-12691466 CACACCCAGCCCTGCAGGACAGG + Exonic
1162810581 19:13162350-13162372 CAACCTCAGCCCCCCGGCCCCGG - Intergenic
1164834931 19:31350333-31350355 CCCACACCGACCCCCGGGACGGG - Intergenic
1164989630 19:32674839-32674861 CCCACTCCGCCCCTCGGGTCTGG - Intronic
1166077350 19:40421331-40421353 CACACTCAGCGGCCTGGCACGGG - Intergenic
1167134617 19:47609335-47609357 CACACTCAGCCCCCCAGCCGGGG + Intronic
1167424401 19:49422623-49422645 CAGCCTCCGCCCCCCAGGACGGG - Exonic
1167736202 19:51295947-51295969 AACACTCAGCTCCCCGAGCCGGG - Intergenic
926730850 2:16034407-16034429 CACACTCACCCCCTCTGGGCTGG - Intergenic
927073264 2:19551111-19551133 CTCACTCAGGTCCCTGGGACAGG - Intergenic
927553204 2:24016514-24016536 CACACTCAGTGCCCCAGGCCAGG - Intronic
927600373 2:24435285-24435307 CACACTCCGTCCCACGGAACTGG + Intergenic
928139017 2:28711639-28711661 CTAACTCAGCACCCCAGGACAGG + Intergenic
932466118 2:71925473-71925495 CAGTCTCTGCCCCCCGGGAGGGG + Intergenic
932873237 2:75425040-75425062 CACACTCAGCCCCTGGTGAGAGG + Intergenic
936286945 2:111188167-111188189 CACACTCTGCCTCCCGGGCTGGG - Intergenic
936935513 2:117835595-117835617 CAAACTCACCACCTCGGGACAGG + Intergenic
937879916 2:126857363-126857385 CACATTCAGCCCCCCAGCTCTGG - Intergenic
938320037 2:130356381-130356403 CACTCTCTGCCCCCCGGCCCCGG + Intronic
940167654 2:150792947-150792969 CACACTAAGCTCCCCGGGTGGGG + Intergenic
946163749 2:217851464-217851486 CACACACACACCCCAGGGACTGG + Intronic
946201875 2:218075365-218075387 AACACCCAGCACCCAGGGACAGG + Exonic
946333197 2:219021939-219021961 CACAGTCAGCCAGCCGGGAGTGG + Intronic
947073480 2:226317132-226317154 CATACTCAGCCCCCTGGAGCAGG - Intergenic
947623656 2:231605943-231605965 CGCACTCAGACCCCCTGGTCAGG - Intergenic
948604069 2:239123610-239123632 CCGACTCAGCCCCACTGGACCGG + Intronic
948857763 2:240738128-240738150 CACTCTCAGCCCTCGGGGAGGGG + Intronic
1171131030 20:22653034-22653056 CACAGCCAGAACCCCGGGACTGG - Intergenic
1173776139 20:45708107-45708129 CACACACAGCATCCCTGGACTGG - Exonic
1175899333 20:62353848-62353870 CCCACTGAGCCCCCAGGGACTGG + Intronic
1176024409 20:62978484-62978506 CACTCTCAGCCACCTGGGACAGG - Intergenic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1176266772 20:64213462-64213484 CACACACAGACACCCAGGACAGG + Intronic
1176299033 21:5089988-5090010 CACACTCATCACCAGGGGACGGG + Intergenic
1176514495 21:7774011-7774033 CCCACCCACCACCCCGGGACAGG + Intergenic
1178648608 21:34404535-34404557 CCCACCCACCACCCCGGGACAGG + Intronic
1179857992 21:44171960-44171982 CACACTCATCACCAGGGGACGGG - Intergenic
1179959099 21:44758362-44758384 CCCACTCAGCCCTCAGGGATAGG + Intergenic
1180029826 21:45199390-45199412 CACACTCAGCCACCTGGAAGAGG + Intronic
1180144245 21:45910421-45910443 CAAACTCTGCCCACTGGGACAGG - Intronic
1180188408 21:46151507-46151529 CCCACCCAGCCCCTCGGGAAAGG - Intronic
1180247467 21:46557762-46557784 CACACTCAGAAGCCCGGGTCTGG - Intronic
1180612537 22:17107344-17107366 CACCCCCTGCCCCCCGGCACTGG + Intronic
1181361100 22:22336745-22336767 GACCCCCAGCCCCCCCGGACAGG - Intergenic
1182124284 22:27805008-27805030 CACACTCAGTGCCCCCGGAGGGG - Intergenic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
1184161392 22:42699529-42699551 CTCAGTCAGCTCCCCGGGCCAGG - Intronic
1184257496 22:43295511-43295533 AGCACTCTGCCCCCTGGGACTGG - Intronic
1184523577 22:45009166-45009188 CGCACTCCCCTCCCCGGGACCGG + Intronic
1184644597 22:45889194-45889216 AGCACTGAGCCCCCCAGGACAGG + Intergenic
1185115872 22:48937529-48937551 CACACTCAGAGTCCCGGGACTGG + Intergenic
950636335 3:14317785-14317807 CACTCTCTGCTGCCCGGGACTGG + Intergenic
953160927 3:40418150-40418172 CACAGTCAGCTCACAGGGACAGG + Intronic
954749552 3:52805918-52805940 CTCACTCAGCTCTCCGGGATGGG + Intronic
954810567 3:53244743-53244765 CACACACAGCACCACGGGATGGG - Intronic
959690065 3:109189092-109189114 CACACTCAGGGCCCAGGGAAGGG + Intergenic
961222846 3:125213210-125213232 CACACGGAGACCCCCGGTACCGG - Intergenic
968284980 3:197503206-197503228 CGCCCTCAGCCCCACAGGACTGG + Intergenic
969660517 4:8524901-8524923 CATACCCAGCCCCCCAGGACAGG - Intergenic
976265926 4:83186061-83186083 CCCACTCCCCCCTCCGGGACTGG + Intergenic
981935064 4:150230406-150230428 CAAACACAGCCCCCAGGGAGAGG + Intronic
985834528 5:2260876-2260898 CGCACTCAGCCCCTCAGGAGGGG + Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
989179738 5:38564506-38564528 CACACCCAGTCCCCCATGACTGG + Intronic
992202910 5:74401611-74401633 CACAGTAAGGCCCCAGGGACTGG - Intergenic
993400977 5:87450794-87450816 CACACTCAGCCTCCTGTGATTGG + Intergenic
998161570 5:139815515-139815537 CACACTCAGCCCCTCCACACTGG + Intronic
1001002068 5:168016972-168016994 CACACTGAGCCACCCAGGATGGG + Intronic
1002199528 5:177519950-177519972 CACACTCAGAGCCCGTGGACTGG - Exonic
1005021523 6:21423530-21423552 CACACTCAGGGGCCCGGGAAGGG - Intergenic
1006084966 6:31589062-31589084 CAGGCTCAGCCTCCTGGGACTGG + Exonic
1006837114 6:37005733-37005755 CACACTCAGCCACGCTGGCCTGG - Exonic
1007370328 6:41422611-41422633 CAAATCCAGCCCCCAGGGACAGG + Intergenic
1007721070 6:43885756-43885778 CACACTCAGCAGCCAGGGCCTGG + Intergenic
1011099937 6:83709218-83709240 CACACACCGCCCCCCGGGGCCGG + Exonic
1013188466 6:107782403-107782425 CACACTCAGCCCCCCGGGACCGG - Intronic
1015660210 6:135566478-135566500 CACACTAAGCCCCCAGGGCAAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018870503 6:167778845-167778867 CACACTCAGCCACATGTGACAGG + Intergenic
1019414980 7:922937-922959 CACACTCAGGCCCGGGGGTCAGG - Intronic
1019736772 7:2653964-2653986 CACACACACCGCCCCAGGACTGG + Intronic
1020116299 7:5478288-5478310 CTCACCCAGCCCCCCTGGGCTGG + Intronic
1020525236 7:9251058-9251080 CACACTAAGCTCCCAGGGAAGGG + Intergenic
1021561415 7:21972128-21972150 CCCACTCAGGTCCCTGGGACTGG + Intergenic
1025199076 7:56950691-56950713 CACTCGCAGCCCCCCAGGGCTGG - Intergenic
1025672871 7:63626242-63626264 CACTCGCAGCCCCCCAGGGCTGG + Intergenic
1030701591 7:112646999-112647021 CACGCTCAGCTCCCTGGGAGGGG - Intergenic
1032201642 7:129826236-129826258 CCCAGTCCGCCCCCAGGGACCGG + Intergenic
1034447072 7:151119200-151119222 CACAACCTGCCCCTCGGGACAGG - Intronic
1034972516 7:155427958-155427980 CACACGCAGTCCCCAGAGACTGG - Intergenic
1035769733 8:2137504-2137526 CACACACAGACCCGTGGGACAGG - Intronic
1039885197 8:41650363-41650385 CAAGCTCAGCCCCCCAGGGCTGG - Intronic
1039947099 8:42139795-42139817 TTCACCCAGCCCCCAGGGACGGG + Intergenic
1042396056 8:68292896-68292918 CCCACTCAGGTCCACGGGACTGG - Intergenic
1043233297 8:77830157-77830179 CACACTAAGCTCCCAGGGTCTGG + Intergenic
1044154252 8:88823718-88823740 CCCACTCAGGGCCCAGGGACTGG + Intergenic
1050437947 9:5629248-5629270 CACACTCAGCGGCCCCGGGCTGG - Exonic
1051604484 9:18906791-18906813 CACACTCCACACGCCGGGACTGG - Exonic
1052999777 9:34571585-34571607 CACACTCAGGCCCCCGCGGGGGG + Intronic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061494300 9:130962927-130962949 CCCAGACAGCCCCCCGGGGCGGG - Intergenic
1061548756 9:131320224-131320246 CAATCTCAGCCCCCAGGGGCCGG + Intergenic
1061852771 9:133425549-133425571 GAAACTGAGCCCCCAGGGACGGG - Exonic
1062243124 9:135550281-135550303 CCCACTGAGACCCCCGGGGCGGG - Intergenic
1062310550 9:135933553-135933575 CCCACTCAGCCCACAGGCACAGG + Intronic
1062600055 9:137315517-137315539 CACCCCCAGCCCTCCTGGACCGG - Intronic
1185550736 X:981027-981049 CACACTCTCCCCCCTGGGGCTGG + Intergenic
1185550785 X:981182-981204 CACACTCTCCCCCCTGGGGCTGG + Intergenic
1185550850 X:981384-981406 CACACTCTGCCCTCTGGGGCTGG + Intergenic
1196178157 X:112662982-112663004 CACATTCAGATCCCTGGGACTGG + Intronic
1199724781 X:150569001-150569023 CCCACTCACCGCCCCGGGACGGG - Intronic
1200474516 Y:3628431-3628453 TCCACCCAGCCCCCCGGGTCAGG - Intergenic