ID: 1013190195

View in Genome Browser
Species Human (GRCh38)
Location 6:107796307-107796329
Sequence CTCCAATTTCGGTCAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013190195_1013190198 9 Left 1013190195 6:107796307-107796329 CCATATCCTGACCGAAATTGGAG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1013190198 6:107796339-107796361 TTTCATTTTAGCAATTCTAGTGG No data
1013190195_1013190200 13 Left 1013190195 6:107796307-107796329 CCATATCCTGACCGAAATTGGAG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1013190200 6:107796343-107796365 ATTTTAGCAATTCTAGTGGGTGG No data
1013190195_1013190199 10 Left 1013190195 6:107796307-107796329 CCATATCCTGACCGAAATTGGAG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1013190199 6:107796340-107796362 TTCATTTTAGCAATTCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013190195 Original CRISPR CTCCAATTTCGGTCAGGATA TGG (reversed) Intronic
916012632 1:160719751-160719773 CTCCAAATTCTGTCAGGTAAAGG + Intergenic
917166709 1:172120489-172120511 TTCCCATTTCTCTCAGGATAAGG + Intronic
1068993513 10:63176498-63176520 CTCCAATTTAAGTAAGGAAATGG + Intronic
1068993725 10:63179059-63179081 CTCCAATGTCTATCAGGATAAGG + Intronic
1069932522 10:71892257-71892279 CTAGATTTTCGGTCAGGACACGG - Intergenic
1081115171 11:39191871-39191893 CACCAATTCCGGACACGATATGG - Intergenic
1092226127 12:6749400-6749422 CTCCAAGTGCGGTAAGAATATGG + Intronic
1097618707 12:61914174-61914196 GTAGAATTTCAGTCAGGATAAGG + Intronic
1109408014 13:61925773-61925795 CTACATTTTCTGTCAGGGTAGGG + Intergenic
1119810945 14:77518946-77518968 CTCCAATTTGGCTTACGATAGGG - Intronic
932693392 2:73932663-73932685 ACCCAATTTTGGTCAGGACAGGG - Intronic
934790082 2:97051689-97051711 CTCCATTTTCAGTCAGCAAAAGG - Intergenic
934816389 2:97330851-97330873 CTCCATTTTCAGTCAGCAAAAGG + Intergenic
934821307 2:97377633-97377655 CTCCATTTTCAGTCAGCAAAAGG - Intergenic
935193174 2:100794339-100794361 CTCCAAAATTGCTCAGGATATGG - Intergenic
941530983 2:166670854-166670876 CTGTAATTTAGGTCAGTATAGGG - Intergenic
946579942 2:221117510-221117532 GTCCAAATTCGGTCTGGCTATGG + Intergenic
947052242 2:226058521-226058543 CTCAAGTTTAGGGCAGGATAGGG - Intergenic
1173818787 20:46007715-46007737 CTGCAAATTGGGGCAGGATATGG - Intergenic
1176933927 21:14844946-14844968 CTCCAATTTCTGACAGGATTAGG - Intergenic
1179333429 21:40427448-40427470 CTCCAATCTGGGTCAGTATCAGG + Intronic
949832163 3:8226413-8226435 CTCCAAGCTCGGACAGGAGAAGG - Intergenic
961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG + Intergenic
989668728 5:43888758-43888780 CTCCAAGTTTGGTCCTGATATGG + Intergenic
989676052 5:43974004-43974026 CTACAATTTTTGTCAGTATATGG + Intergenic
994671358 5:102765433-102765455 CTGCAATTTAGATGAGGATATGG - Intronic
1013190195 6:107796307-107796329 CTCCAATTTCGGTCAGGATATGG - Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1017003478 6:150013205-150013227 CTCCAATCTGGGACAGGATTGGG - Intergenic
1031453910 7:121956310-121956332 CTGGAATTTCAGTCAGGACATGG + Intronic
1037029294 8:14083295-14083317 CTCCAATTTCTAGCAGGATGTGG + Intergenic
1043056029 8:75440628-75440650 CTTTAATTTTGGTCAGGACAAGG - Intronic
1049281589 8:141752168-141752190 CACCAAGTGAGGTCAGGATATGG + Intergenic
1050819478 9:9859494-9859516 GTGCAATTTGGCTCAGGATAAGG - Intronic
1051330669 9:16022176-16022198 ATTCAATGTCGGTTAGGATATGG - Intronic
1052639676 9:31150773-31150795 CTACAATTTCTTTCAGGAAATGG + Intergenic
1057020269 9:91691908-91691930 CTCCCATTTCAGTGGGGATAGGG + Intronic
1059227879 9:112690129-112690151 CTCCTATTACTGTTAGGATAAGG - Intronic
1060513825 9:124253520-124253542 GGGGAATTTCGGTCAGGATAGGG - Intergenic
1060577239 9:124707883-124707905 CTGCAACTATGGTCAGGATAAGG + Intronic
1060810517 9:126609435-126609457 CTCCACATTGGGTCAGGAGACGG - Intergenic
1189236170 X:39489007-39489029 CTCCAATTTGGGCCAGCACAGGG + Intergenic
1190625835 X:52337664-52337686 CTCTCATTTTGGTCAGGATCTGG + Intergenic
1192224265 X:69217528-69217550 CCCCAATTTGGTTTAGGATAGGG + Intergenic