ID: 1013190444

View in Genome Browser
Species Human (GRCh38)
Location 6:107800559-107800581
Sequence TTCTCAGCAAAATTCAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013190441_1013190444 -9 Left 1013190441 6:107800545-107800567 CCTTCACTGGTCCTTTCTCAGCA 0: 1
1: 0
2: 1
3: 28
4: 294
Right 1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG 0: 1
1: 0
2: 7
3: 51
4: 471
1013190440_1013190444 -4 Left 1013190440 6:107800540-107800562 CCTTTCCTTCACTGGTCCTTTCT 0: 1
1: 1
2: 3
3: 58
4: 639
Right 1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG 0: 1
1: 0
2: 7
3: 51
4: 471
1013190438_1013190444 4 Left 1013190438 6:107800532-107800554 CCTATTAGCCTTTCCTTCACTGG 0: 1
1: 0
2: 2
3: 7
4: 156
Right 1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG 0: 1
1: 0
2: 7
3: 51
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013190444 Original CRISPR TTCTCAGCAAAATTCAGAAA GGG Intronic
902164372 1:14558138-14558160 TTCTCTGCAGAATTTAGGAAGGG - Intergenic
902172093 1:14620303-14620325 CTCTCAACAACTTTCAGAAATGG - Intronic
903249431 1:22041885-22041907 TTATCAGCAAAAGTCAGGCATGG - Intergenic
903545067 1:24118821-24118843 TTCTCAGAAATGTTCAGAAAAGG + Intergenic
903799570 1:25956541-25956563 TCCTCAGCATTATTGAGAAATGG - Intergenic
903832381 1:26182939-26182961 TTCTCAGCAACATTCCTAAAGGG - Intronic
903866853 1:26405553-26405575 TTCTCAGAGTACTTCAGAAATGG + Intergenic
904045313 1:27604819-27604841 TGCTCAGCAGAATTCGGAAAAGG - Intergenic
904308093 1:29603447-29603469 TTCTCAGGAAAATTCCTAATGGG + Intergenic
905078792 1:35298432-35298454 TTCTTAGCCAGATTCAGCAAGGG - Intronic
905620568 1:39442388-39442410 TACTCAGGAAAAGACAGAAAGGG - Intronic
906336376 1:44935321-44935343 TTCTCACTGAAATTGAGAAAAGG + Intronic
906796886 1:48703729-48703751 TGCTAAGGAAAATTCAGAGATGG - Intronic
907176264 1:52525920-52525942 TTCACAGGCAAAATCAGAAAAGG - Exonic
907178679 1:52551307-52551329 TTCTTAAAATAATTCAGAAATGG - Intronic
907645455 1:56238088-56238110 TTCTCAGGAAAAGTCTGGAAAGG - Intergenic
907764797 1:57398520-57398542 CTCTCAGCAAAGTTCCCAAAGGG - Intronic
907823827 1:57996289-57996311 TTCTCATCACAATTCTGAATGGG - Intronic
908279239 1:62513091-62513113 TTCACAGCAAAAGTGAGCAAAGG - Intronic
908381250 1:63598943-63598965 ATCTCATGAAAGTTCAGAAAAGG - Intronic
910115541 1:83727887-83727909 TTTACAGCAAAATTCTGAAAGGG - Intergenic
910351425 1:86302998-86303020 TGCTAACCAAAATTAAGAAAAGG - Intergenic
910600066 1:89021469-89021491 TTCTTAGCAACATTCAGTATTGG - Intronic
912137103 1:106674499-106674521 TTCTCATGAAGAATCAGAAATGG + Intergenic
912137307 1:106677190-106677212 TACTTGGCAAAATTCAAAAATGG + Intergenic
912243387 1:107935771-107935793 TTCTCTGCAAAATACAGCATAGG - Intronic
912486359 1:110032204-110032226 TTTTCAGCTAAATTTAGAACAGG - Intronic
913029732 1:114888968-114888990 TTCTCAGCAAAAATATCAAAAGG - Intronic
914897881 1:151693093-151693115 TTTTCAGCTAAATGCATAAATGG + Intronic
916796704 1:168174147-168174169 TTTTCAGCCAAATTGGGAAAAGG - Intergenic
916892139 1:169122244-169122266 GGCTCAACAAAATTCAGAATGGG - Intronic
916913883 1:169384726-169384748 TTGCCAGCAAGATTCAGAGAAGG - Intronic
917587286 1:176440271-176440293 TAATCAGCAAAATCCAGCAAGGG - Intergenic
917935423 1:179862205-179862227 ATATCAGCAAAATAGAGAAAAGG - Intronic
917982706 1:180281380-180281402 TACTCAGCTAAAATCACAAAAGG + Intronic
918270093 1:182889913-182889935 TTCTAAGCAAAATGTAGAGATGG - Intergenic
918321787 1:183371589-183371611 TTCACAGTAAAATTGAGAGAAGG - Intronic
918737821 1:188088756-188088778 TTGTCAGCAAACATCAAAAATGG - Intergenic
918914982 1:190623511-190623533 AACACAGCAAAATTCAGATAAGG + Intergenic
919074909 1:192801284-192801306 TTCTTAAGAAAATCCAGAAAAGG - Intergenic
919229567 1:194756157-194756179 TTCTAAACAAAATGCAAAAAGGG - Intergenic
919570741 1:199243848-199243870 ATTTGGGCAAAATTCAGAAATGG - Intergenic
920156463 1:203956008-203956030 TTCTCAGCAAAATGAAGAAAAGG - Intergenic
920576500 1:207064739-207064761 TTCTCAGGAAAGTACATAAAGGG + Intronic
920616218 1:207495452-207495474 TTCTCAGCAAACTACCGCAAGGG + Intergenic
923282993 1:232462532-232462554 GACTCAGCAAAATGCGGAAAGGG + Intronic
924129606 1:240892459-240892481 TCCTCAGTGAAATTCAGAAATGG + Intronic
1063346296 10:5315219-5315241 TCCTCAGCAAAACAAAGAAACGG - Intergenic
1063604388 10:7509474-7509496 TTCACAGCAAAATTGAGAAGAGG + Intergenic
1063655494 10:7984134-7984156 TTTTCTGGAAAAATCAGAAAAGG - Intronic
1063915868 10:10881621-10881643 TTCTCATCAAAAGTCAGATCGGG - Intergenic
1064062058 10:12146428-12146450 TTCTCAGGAAAATGCAGCACAGG - Intronic
1065282279 10:24151672-24151694 CACTCAGCAAAATTCAGGGAGGG - Intronic
1065753479 10:28909876-28909898 TTCCCAGGAAAATTCAGAAGGGG - Intergenic
1067136801 10:43616143-43616165 TTCTCAGCAAGAATCACAAGTGG + Intronic
1067749396 10:48960133-48960155 TGCTCAGCATAGTTCAGAGAGGG + Intronic
1068455879 10:57253064-57253086 ATCTGACCAAAATTTAGAAATGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069516494 10:69081864-69081886 CTCTCGGGAAATTTCAGAAAGGG - Intergenic
1070446123 10:76505147-76505169 TTCTCAGCAGAATTCTTACAAGG - Intronic
1070588871 10:77787473-77787495 TTCTCAGCAAAATAGAGGAGAGG + Intergenic
1070910360 10:80112461-80112483 TTCTCCACAAAAGTCATAAAGGG + Intergenic
1070970604 10:80563854-80563876 TCCTTAGGAAAATTGAGAAAAGG + Intronic
1072223614 10:93348241-93348263 TTCTGAGCAGACTTTAGAAATGG + Intronic
1073122370 10:101130644-101130666 TTCTTAGACAAATTCAGGAAGGG - Exonic
1073288694 10:102402874-102402896 GTCTCAGCAGAAAGCAGAAACGG + Exonic
1073590753 10:104755376-104755398 TTCTCAAGAAAATTCACATATGG - Intronic
1075404023 10:122182505-122182527 TTCTCAGCAGGACTCAGTAATGG + Intronic
1076243256 10:128926407-128926429 ACCTGAGCAAAACTCAGAAACGG - Intergenic
1078588628 11:12618157-12618179 TTCTAAGCAAAATGAATAAATGG - Intergenic
1079632314 11:22692994-22693016 ATCTCATGAAAATGCAGAAAGGG - Intronic
1079633170 11:22702784-22702806 TTCTCAGCAGAGTACAGAATAGG - Intronic
1079955463 11:26857704-26857726 ATTTCAGCAAAATTCAGTATTGG + Intergenic
1079977690 11:27112449-27112471 TTCTCAGATAAATACACAAATGG + Intronic
1080006554 11:27413925-27413947 CTCTCACTAAAATTTAGAAATGG + Intronic
1080326765 11:31083603-31083625 TTTTCAGAAAAAATCTGAAATGG - Intronic
1080925681 11:36753716-36753738 CTCGCTGCAAAATTGAGAAATGG - Intergenic
1081284149 11:41246738-41246760 TTCTCAGTGAAATGAAGAAAGGG - Intronic
1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG + Intergenic
1081490257 11:43562683-43562705 GTCTCTGCTAATTTCAGAAAAGG - Intronic
1084107267 11:66988295-66988317 TTCTGATCAAAATTCAGAAATGG + Intergenic
1085074228 11:73575567-73575589 TTCTCATTAAGATTTAGAAATGG + Intronic
1085162165 11:74358276-74358298 TTCACAGCAAAATTCAGTGGAGG - Intronic
1085516263 11:77113522-77113544 TTTTCAGCAAGATTGACAAATGG - Intronic
1086891232 11:92260475-92260497 TTGTCAGCAAAATTCAACTAAGG - Intergenic
1087559459 11:99767732-99767754 TTCTCAGCAAGATAAAGAGAAGG - Intronic
1088001487 11:104887123-104887145 TTCTTATAAAAATTCACAAATGG + Intergenic
1088094465 11:106082160-106082182 TTCACAACAAAATAAAGAAAAGG - Intronic
1089402659 11:118173253-118173275 TTTTCAGAAAAAATCAGAACTGG - Intronic
1090054236 11:123408207-123408229 TTCTCAGCCACTCTCAGAAAAGG + Intergenic
1091484454 12:871086-871108 TTGTAAGAAAAATTTAGAAAAGG - Intronic
1091917332 12:4279109-4279131 TTCTCTGCTAAACTCATAAATGG + Intronic
1092241750 12:6840066-6840088 GTCTCAGCAAAGCTCAGAGAGGG - Intronic
1093202949 12:16211418-16211440 TTCTCCTCAAAATTCGGGAAAGG - Intronic
1093742058 12:22700173-22700195 TTCTCAGCTAAAGCAAGAAAGGG - Intergenic
1094787955 12:33873021-33873043 TTATCATTAAAATTGAGAAATGG + Intergenic
1095266515 12:40165075-40165097 TTCTGTGCAAAATTCAGTGAAGG - Intergenic
1095436876 12:42198683-42198705 TGCTCTGTAAAATTCCGAAATGG + Intronic
1095537888 12:43273517-43273539 TTCTCAAAAGAAGTCAGAAACGG + Intergenic
1095763265 12:45865274-45865296 TTCTTAACAATATTGAGAAATGG - Intronic
1095819854 12:46466058-46466080 TTCTCAGCCAGTTGCAGAAAGGG - Intergenic
1097105186 12:56618390-56618412 TTCTTAGTAGTATTCAGAAAGGG - Intronic
1097152216 12:56987412-56987434 TTCTCAGGAGACTACAGAAAGGG + Intergenic
1097421446 12:59385598-59385620 TTCACAGGAAATTTTAGAAAAGG + Intergenic
1097649335 12:62276885-62276907 TACACAGCAAAATGCATAAAAGG - Intronic
1097788029 12:63782668-63782690 ATCTCAGCAGAAGCCAGAAATGG - Intronic
1097911045 12:64969392-64969414 TTCTCAGCAAAATTCATGGTTGG - Intergenic
1097998708 12:65918163-65918185 ATCTTAGCAAAATGAAGAAATGG + Intronic
1098069346 12:66655343-66655365 TTCTCTGCAAAATTGAGAAAAGG + Intronic
1098364903 12:69692244-69692266 TTTTCAGGACATTTCAGAAAAGG + Intronic
1098450657 12:70614763-70614785 TTCGAAGTAAAACTCAGAAAAGG - Intronic
1098911825 12:76216966-76216988 TTCACAGCAAAATTGAGAGGAGG - Intergenic
1099096385 12:78379418-78379440 TCCTCAGAAAAATTAAGAAATGG + Intergenic
1099159024 12:79216519-79216541 TTCTAAGAAAAATCCAGGAAGGG + Intronic
1099681427 12:85834379-85834401 TTCTATGCAAAATTATGAAAAGG - Intronic
1100119124 12:91347822-91347844 TTCTTAGCAAACTTTAGAAGTGG - Intergenic
1100322586 12:93509813-93509835 TTCTGAGCAAAATTGAGAGGAGG + Exonic
1100547690 12:95618992-95619014 GTATCATCAAAATTCAGTAAAGG + Intergenic
1100567420 12:95810978-95811000 TTCCCAACAAAATGCATAAATGG + Intronic
1101219433 12:102622098-102622120 TTCACAGCAACATTCAGCAGAGG - Intergenic
1101603444 12:106230318-106230340 ATCTCTACAAAATTCAAAAATGG + Intergenic
1101918480 12:108914133-108914155 TTCTCTGCAATATTCAGACTTGG + Intronic
1101974213 12:109341251-109341273 TTCACAGCACATTCCAGAAATGG + Intergenic
1102922318 12:116801061-116801083 TTCTCAGCAACACTCTGAGAAGG + Intronic
1103219381 12:119231129-119231151 TTCTCACCAAAATTCACAGTGGG + Intergenic
1105567268 13:21562469-21562491 TACTCAGCTAAAATCAGAGAAGG - Intronic
1106258338 13:28041840-28041862 TTCTCATTAAAACTAAGAAAAGG + Intronic
1108198602 13:48020036-48020058 TTCTCAACAAATTTCAAATAAGG + Intergenic
1108859125 13:54831546-54831568 TTCTCAAAAAAATGTAGAAATGG + Intergenic
1109269624 13:60240208-60240230 TTCTAAGGAAAATTCAGTAAAGG + Intergenic
1109297252 13:60549392-60549414 ATGTCAGCAAAATTCAGTATTGG + Intronic
1109796005 13:67314027-67314049 TTAACAGAAAAAATCAGAAAGGG - Intergenic
1110595316 13:77314888-77314910 TTCATAGCAAAATTGAGAAGAGG - Intronic
1110752149 13:79127157-79127179 TTCTTAGAAAAATTGAGAACAGG + Intergenic
1111066372 13:83098381-83098403 TTCTCAGCAAAATTTAATGATGG - Intergenic
1111077761 13:83261161-83261183 TTTCCACTAAAATTCAGAAATGG + Intergenic
1111545348 13:89726709-89726731 TTCTCAGTAAAATTGAGCATAGG + Intergenic
1111837819 13:93410907-93410929 TTCTAGGCAAAATTCAGCTATGG + Intronic
1111984801 13:95054959-95054981 TCCTCAGCAAAATGCAAAAATGG + Intronic
1112569083 13:100577760-100577782 TTCACAGTAAAATGCTGAAAAGG + Intronic
1113095775 13:106662433-106662455 TTCTCAGCAAAGTTGAGAGTGGG - Intergenic
1113468214 13:110526684-110526706 TTGGCAGCAAACTGCAGAAATGG + Intronic
1114961413 14:27895301-27895323 TTATCAAAATAATTCAGAAATGG - Intergenic
1116760632 14:49008780-49008802 TTCACTGTAAAAATCAGAAAAGG + Intergenic
1117215346 14:53545856-53545878 TTCTAAGCAAAAATCACAAGGGG - Intergenic
1117271224 14:54146027-54146049 CTGTCAGAAAAAATCAGAAATGG - Intergenic
1117686654 14:58260508-58260530 TTCTCTGCAATAATCAGAATTGG - Intronic
1118126997 14:62916576-62916598 TTCTCATCAGAAATCAGAGAAGG - Intronic
1119940919 14:78640336-78640358 TTCTCAGTAAAATTATGCAATGG + Intronic
1120183932 14:81372998-81373020 TACTCAGGAATATGCAGAAAGGG - Intronic
1123214989 14:106800385-106800407 TTCTCAATAAAAATGAGAAAAGG + Intergenic
1124891109 15:33733859-33733881 TTCACAGCAAAATTGAGCAAAGG - Intronic
1125471821 15:40012081-40012103 TGATCAGCAAAATTCACATATGG + Intronic
1125785597 15:42314285-42314307 TTCTCAGCAGAATTTCCAAAGGG + Intronic
1125984194 15:44033656-44033678 TTCTGAGCTAATTTCAAAAACGG + Intronic
1126540058 15:49812593-49812615 TTCACAGCAAAATTAAGAGGAGG - Intergenic
1126692252 15:51296728-51296750 TACTTAGCAAAATTTAAAAATGG + Intronic
1128819286 15:70637623-70637645 TTCTGGTCAAAATTAAGAAAAGG + Intergenic
1128875687 15:71199317-71199339 TTCTCTGCACAAGTCAGAACTGG + Intronic
1128921823 15:71617753-71617775 AGCTCAGCAAAATTCACGAATGG - Intronic
1129175764 15:73838797-73838819 TTCTCATGCAACTTCAGAAAGGG + Intergenic
1129541727 15:76355387-76355409 TTCTCAGCCAGAGTCAGAAATGG - Intronic
1131211468 15:90500820-90500842 TACTCAGATAAATTCAGAATGGG + Exonic
1131219660 15:90571763-90571785 TTCCCAGAAAACTGCAGAAAGGG - Intronic
1133880526 16:9777500-9777522 TTCTCAGCATTATACAGAAATGG - Intronic
1135273391 16:21087971-21087993 TTCTTAGCAAAATAAAGGAAGGG - Intronic
1136101040 16:27996216-27996238 TCCTGAGCAGAATTCAGATATGG - Intronic
1136624300 16:31452559-31452581 TGCTCAGCAAATTTCTGAATGGG + Intergenic
1137611864 16:49823598-49823620 TGCTCTGCAACATTCCGAAAGGG + Intronic
1138330332 16:56209760-56209782 TTCACAGCAGAATTGAGAAAGGG + Intronic
1138563278 16:57814975-57814997 AACTCAGCAAAATTCAAATATGG + Intronic
1139150745 16:64379549-64379571 TTTGCAGCAAAATTCTAAAATGG - Intergenic
1139669539 16:68483163-68483185 TTTTCAGCAGACTTGAGAAAGGG - Intergenic
1140630657 16:76848080-76848102 TTCTAAGCATAACTCTGAAAGGG - Intergenic
1140750004 16:78014773-78014795 TTCTCACAAAAAATAAGAAAAGG - Intergenic
1140974979 16:80051055-80051077 TCCTCAGGAAAAATCTGAAAGGG + Intergenic
1141601680 16:85130577-85130599 TTCACAACAAACTTCAGAGAAGG + Intergenic
1143442728 17:6988088-6988110 TTCTCAGCACAATGGAAAAAAGG - Intronic
1143607255 17:7995045-7995067 TTATCAGGAAAATTCTGGAAAGG + Intergenic
1143652219 17:8270415-8270437 TTCTCACTAAAATTCAGCAAAGG + Exonic
1144015801 17:11194533-11194555 TTATAAACAAAATTCAGCAATGG + Intergenic
1144249602 17:13402397-13402419 AGCTGAGCAGAATTCAGAAAAGG + Intergenic
1144249756 17:13404008-13404030 AGCTGAGCAGAATTCAGAAAAGG + Intergenic
1144412150 17:15011769-15011791 TACTCAGGAAAGTACAGAAAGGG + Intergenic
1145119154 17:20241029-20241051 ATCTGAGCAGAATTCAGACACGG - Intronic
1146019338 17:29263502-29263524 TTCTCAGCAAAATCTAAAAGGGG - Exonic
1148360359 17:47006934-47006956 TTCTCAGCACTATTCGGAAATGG - Intronic
1148480366 17:47956056-47956078 TTCTCAGCAAACTGTAGAGATGG + Intronic
1148498570 17:48071185-48071207 TTCGCAGCAAAGTGCAGAAAAGG + Exonic
1148684411 17:49493246-49493268 CTCTCAGCTGAATTCATAAAAGG - Intergenic
1148810408 17:50286931-50286953 TTCTCAGCTAAAGTAAGACAAGG - Intergenic
1149334777 17:55624399-55624421 ATCTAAGGAAAAATCAGAAATGG - Intergenic
1149391387 17:56194849-56194871 TTCACAGCAAAATTGATAGATGG - Intronic
1149674381 17:58446470-58446492 ATCGCAGCAAAATACAGCAAGGG + Intronic
1150586566 17:66523644-66523666 TTCTCAGCCATATTCAGGGAAGG - Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151033777 17:70774014-70774036 TTCTTAGGAAAATACTGAAATGG + Intergenic
1151424175 17:74019263-74019285 TTCTCAGCAAAATCACCAAAAGG + Intergenic
1151810358 17:76436752-76436774 TTCTGAACAAAATTCAAAAAAGG + Intronic
1153669267 18:7394571-7394593 TTCTTAGTGAAATTGAGAAATGG - Intergenic
1154099760 18:11461049-11461071 TTAAAAGCACAATTCAGAAAAGG - Intergenic
1156287460 18:35712357-35712379 TTCTCAGCTAAATGTAGAATGGG - Intergenic
1156635453 18:39022703-39022725 TTCATAGCAAAAGTCAGGAAAGG - Intergenic
1156845387 18:41659690-41659712 TTCTGAGCAAAAGTCAAAATAGG + Intergenic
1157077851 18:44486117-44486139 TTTTCAGAAAAATAAAGAAAAGG + Intergenic
1158326473 18:56318800-56318822 TTCCCAGTAAAAATCAGAATAGG + Intergenic
1158552590 18:58449290-58449312 TAATCTGCAAAATACAGAAAAGG - Intergenic
1158780561 18:60644568-60644590 CTATCAGCATAATTCAGAAAGGG - Intergenic
1159345168 18:67192737-67192759 TTCGTTGCAAAATCCAGAAAAGG - Intergenic
1159567079 18:70063725-70063747 TTTACAGAAAAATTCAAAAAAGG - Intronic
1159927952 18:74285466-74285488 TACACAGCCAAATTCAGGAAGGG + Intronic
1160530023 18:79557284-79557306 TTCTCAGCAACATGCAGTAGAGG + Intergenic
1162403303 19:10458954-10458976 GTCTCTCCAAAATTCAGAAAAGG - Intronic
1163212550 19:15851927-15851949 CACTCAGCAGAAATCAGAAAAGG + Intergenic
1165211079 19:34236336-34236358 TACAAAGCAAAATTCACAAAGGG + Intergenic
1165891916 19:39117757-39117779 TTTTCAGCAAATTTTAAAAATGG + Intergenic
1167774572 19:51546254-51546276 GTCTGAGCAACATGCAGAAATGG - Intergenic
1167809875 19:51820079-51820101 TTCTCATTAAAATTCAGCCAAGG + Intronic
1167953673 19:53047371-53047393 TTCTCTGCAGAATTCAGCAGGGG + Intronic
925420632 2:3707851-3707873 GTTTCAGCAATATTCAGAGAAGG - Intronic
926650762 2:15341863-15341885 TGCTCACTAAAATGCAGAAATGG + Intronic
926663565 2:15494888-15494910 TCCTCAGCAAAATGAAAAAAGGG - Intronic
927448955 2:23189831-23189853 TTATCAGTACAATGCAGAAAGGG - Intergenic
929375469 2:41281672-41281694 ATTTCAGCAAAATACAGCAAGGG + Intergenic
929634294 2:43501478-43501500 TTCTAACCAAAATTCCAAAAGGG + Intronic
930738581 2:54805149-54805171 TTCTCAGCCATAAACAGAAATGG - Intronic
931559664 2:63546162-63546184 TGATCAGCAAAATGGAGAAATGG + Intronic
932132280 2:69198787-69198809 TACTCAGGAAGATGCAGAAAAGG - Intronic
932517258 2:72364919-72364941 TTTTCCTCAAAATTCAGAGAAGG + Intronic
932934112 2:76081240-76081262 TTCTCACCACACTTGAGAAAGGG + Intergenic
933474529 2:82772285-82772307 TTCTCAGCAAAAACCACACAAGG + Intergenic
933831742 2:86216848-86216870 TCCCCAGCAAAATAAAGAAAAGG + Exonic
935513145 2:104001293-104001315 GAGTTAGCAAAATTCAGAAAGGG + Intergenic
937475712 2:122213454-122213476 TTCTCAGGAAACCTCTGAAAAGG - Intergenic
937621004 2:123985342-123985364 TTCTCAACAAAAATCAGGAAGGG + Intergenic
937630299 2:124094176-124094198 TTTTCAGCAAAGGGCAGAAATGG + Intronic
938269150 2:129954018-129954040 TTCTCCACAAAAGTCATAAAGGG - Intergenic
939273324 2:139968088-139968110 TTTTCCTCAAAACTCAGAAATGG - Intergenic
939283927 2:140103835-140103857 TTCTCACCTTAATCCAGAAAAGG - Intergenic
939476444 2:142693891-142693913 TGCTCAGAAATATTCACAAACGG - Intergenic
939865203 2:147464870-147464892 TTATCAGCATAGTTCAGAACTGG - Intergenic
940313013 2:152298289-152298311 TTCACAGCAAAACTGAGCAAAGG + Intergenic
940570278 2:155423518-155423540 TTCTCAACAAAATATATAAATGG - Intergenic
940595523 2:155787394-155787416 TTCAAAGCAAAAGTCACAAAGGG - Intergenic
943193028 2:184705185-184705207 TTCATAGCATAATTGAGAAAAGG + Intronic
943295332 2:186131083-186131105 TTTTCAGCAATTTACAGAAATGG - Intergenic
943769454 2:191700697-191700719 TTCACAACAAAATTCAAATAAGG - Intergenic
944410485 2:199437053-199437075 TTTTCAACAAAATTTAGAAATGG + Intronic
945916914 2:215713968-215713990 TTCTCAGTAAAATCCTGGAAAGG - Intergenic
946185844 2:217979934-217979956 TTCTCAGCAGACTGCAGAAAGGG + Intronic
946439347 2:219681903-219681925 TACTCAGCAATAGTCAGCAAGGG + Intergenic
946730023 2:222700414-222700436 TTCTCTTAAACATTCAGAAAGGG + Intronic
946793154 2:223321675-223321697 TGCTCCGCAAAATTCAGTGATGG + Intergenic
947107640 2:226684475-226684497 TTCTTAGCCAAGTCCAGAAAAGG + Intergenic
947372169 2:229458221-229458243 TTCTCTGTTAAAATCAGAAAAGG + Intronic
948225163 2:236304114-236304136 TCCTCAGCAAATTTCAGACCTGG - Intergenic
948925974 2:241098083-241098105 AGCTGAGCAAAATTCAGTAATGG + Intronic
1169293928 20:4376369-4376391 TTCTCAGTCATATTCGGAAAAGG + Intergenic
1169659408 20:7961793-7961815 TCATCAACAAAATTCATAAAAGG - Intergenic
1172739451 20:37154277-37154299 TCCTCAGAAAAATCCAGAAGAGG + Intronic
1172758517 20:37305396-37305418 AGTTCAGCAAACTTCAGAAAAGG + Intronic
1172833254 20:37854889-37854911 TTCTCAGAAATATTGAGAAGCGG - Intronic
1173881869 20:46420716-46420738 TTCTCTGCATCTTTCAGAAATGG + Intronic
1174836019 20:53855776-53855798 TTCTTAGCAAAGTTCAGACATGG + Intergenic
1176334304 21:5581561-5581583 TTCGCAGGAAAATGGAGAAAGGG + Intergenic
1176393453 21:6239391-6239413 TTCGCAGGAAAATGGAGAAAGGG - Intergenic
1176467966 21:7076783-7076805 TTCGCAGGAAAATGGAGAAAGGG + Intronic
1176491527 21:7458561-7458583 TTCGCAGGAAAATGGAGAAAGGG + Intergenic
1176509115 21:7679822-7679844 TTCGCAGGAAAATGGAGAAAGGG - Intergenic
1176855230 21:13963171-13963193 TTCACAGCAAAATTGAGGGAAGG - Intergenic
1177545377 21:22551075-22551097 TTGCCTGCAAAATTCAGAACAGG + Intergenic
1177596628 21:23251495-23251517 TTCTCAGCCTAATTCTGACAGGG - Intergenic
1177746875 21:25226300-25226322 TTCTCATCAAAAATCATAACTGG - Intergenic
1178424974 21:32471929-32471951 TTCTCTGCAATATTAAGAAATGG - Intronic
1178758483 21:35376797-35376819 TTGTCAGAAAAATACAGAAATGG - Intronic
1179156426 21:38855411-38855433 TTCTCAAGGAAAATCAGAAAAGG + Intergenic
1179416073 21:41199614-41199636 TTCTGAGCTGAATTAAGAAAAGG - Intronic
1181236222 22:21449118-21449140 TTCTCATTAAAACACAGAAAAGG - Exonic
1182438973 22:30350509-30350531 CTCTAAGGAAAATACAGAAATGG + Intronic
1182665600 22:31957000-31957022 TTCTCCACACAATTCAAAAAGGG - Exonic
1183286501 22:36967824-36967846 TTTTCAGCATAATTCTGAGAAGG + Intergenic
1183456934 22:37927908-37927930 ATCTCAAAAAAATTAAGAAAAGG - Intronic
1183765053 22:39865582-39865604 TAGGCAGCAAAATTAAGAAATGG + Intronic
1184577930 22:45388674-45388696 TGCTCAGAAAAATTAAGAATAGG + Intronic
949653989 3:6195308-6195330 TTTTCAGCAAAATTTAGTAATGG + Intergenic
951021434 3:17784911-17784933 TTCTCAGCAACATTGTGGAAGGG + Intronic
951579915 3:24151688-24151710 TCATCAACAAAATTCAGATAAGG - Intronic
952727557 3:36603622-36603644 TGCTCAGCAAAATCAACAAACGG + Intergenic
952782934 3:37121676-37121698 TTCCCAGGAAGATTCGGAAAGGG - Exonic
954651124 3:52163769-52163791 TTTTAAGCAAAAATCATAAAAGG - Intergenic
955003633 3:54949699-54949721 GCCTCAGAAAAATTCAGAACTGG + Intronic
955923173 3:63979767-63979789 AACTCAGCAGACTTCAGAAATGG - Intronic
956338583 3:68193915-68193937 TGCTCAGCCAAATTCAGCCAAGG - Intronic
956428242 3:69158817-69158839 ATCTCAGCAAAGGCCAGAAAGGG + Intergenic
956904576 3:73752632-73752654 TTCAAAGCAAAGTTCAAAAAGGG + Intergenic
957801646 3:85092160-85092182 CTATCAACAAAATTCAAAAATGG - Intronic
958738840 3:98043421-98043443 GTCTCAGCAGATTTCAGAGAGGG - Intergenic
959256091 3:104016513-104016535 TTTTCAGCCAAATTCAGGGAAGG - Intergenic
962117207 3:132523380-132523402 TTCTTAATAAAGTTCAGAAAGGG - Intronic
962661882 3:137609994-137610016 TTCTCACCAATCTACAGAAATGG + Intergenic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
963057472 3:141198354-141198376 TTCTCAATAGAATGCAGAAAAGG + Intergenic
963500562 3:146120379-146120401 TTCCCAGCACCATACAGAAAGGG - Intronic
963668236 3:148217591-148217613 TTAGCAGTGAAATTCAGAAACGG + Intergenic
963827031 3:149967085-149967107 TACTCAGTATCATTCAGAAAAGG + Intronic
964422286 3:156516311-156516333 ATCTCAGGAAAATACGGAAACGG + Exonic
964816222 3:160720083-160720105 TTGCCAGCAGAATTCAGATAGGG - Intergenic
965285316 3:166811809-166811831 TTCTCAGCAAAGTTTAAAACCGG - Intergenic
965513598 3:169596477-169596499 TTTTCAGCAGAATTCATAATGGG + Intronic
966588106 3:181650114-181650136 TTCTCAGGAAAATGCAGTTAAGG - Intergenic
970509147 4:16763019-16763041 GTCTCAGGAAATTTCAGAAGAGG + Intronic
970647100 4:18135053-18135075 TTCACAGCAAAATCCAGAGAGGG - Intergenic
970786543 4:19804084-19804106 ATCTCAGCAGAAGGCAGAAATGG - Intergenic
970882987 4:20953744-20953766 TTATCTGCAAAATGCAGAGATGG - Intronic
971359636 4:25925123-25925145 TTCTCAACCAATTTCAGATAAGG + Intronic
972024700 4:34362333-34362355 TTCTCAGCAAATTGCTGCAAGGG + Intergenic
972231354 4:37075963-37075985 CAATAAGCAAAATTCAGAAAAGG - Intergenic
972318516 4:37950523-37950545 TTCACAGCAAAATTGAGAAGAGG + Intronic
972972989 4:44600276-44600298 TTCCCAGCAAAATTTACAGAGGG + Intergenic
973066058 4:45794559-45794581 TTATTAGCAAAATGCAGAAGAGG - Intergenic
973145271 4:46817932-46817954 TTCTCAGCAGAACACAGAAAAGG + Intronic
973314164 4:48742142-48742164 TTCACAGCAAAATTGAGAGGAGG - Intronic
974423955 4:61716280-61716302 TACTCAGGAAAATTTAGAAAAGG - Intronic
974428855 4:61771020-61771042 GTCTCAGCAAAAAACAAAAAGGG + Intronic
975549492 4:75596562-75596584 CTTTCAGCAAAATTCCCAAATGG + Intronic
975954049 4:79814823-79814845 TTATCACCAATATACAGAAATGG + Intergenic
975979304 4:80138355-80138377 TTCTCAACAAAAGACAAAAAAGG + Intergenic
976931862 4:90576240-90576262 TTCACAGCAAAATTGAAAGATGG + Intronic
977177258 4:93832556-93832578 TTCTGAGCCAGATTCAGAACAGG - Intergenic
977274143 4:94954527-94954549 TTCTCATCACAATTCTGCAAAGG - Intronic
977317841 4:95473459-95473481 TTCTCAGCAAAAAAGAGAAAAGG - Intronic
977690811 4:99907710-99907732 TTCTCAATAATATTCAGAGAGGG + Intronic
978459834 4:108939403-108939425 TTCACAGCAGCTTTCAGAAAGGG + Intronic
979839471 4:125420310-125420332 TTCTCAGAAACACTTAGAAAAGG + Intronic
979912383 4:126383879-126383901 TTCTCAGGAAATTGCATAAAGGG - Intergenic
980677540 4:136107781-136107803 TTATCATCAAAAATTAGAAATGG - Intergenic
980685740 4:136225333-136225355 ATCCCAGCAGAATCCAGAAATGG - Intergenic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
982234712 4:153241732-153241754 TTCTGAGATAAGTTCAGAAAAGG - Intronic
982336559 4:154246013-154246035 TCCACAGCAAAATTGAGAGATGG - Intronic
982351641 4:154421981-154422003 CTCTCAGCATCATTCAGTAAAGG + Intronic
982435032 4:155375394-155375416 GTCTCGGCATATTTCAGAAATGG + Intronic
982588262 4:157270993-157271015 TATTAAGCAAAGTTCAGAAAAGG + Intronic
983046216 4:162989569-162989591 TCCTGAGAATAATTCAGAAAGGG - Intergenic
983218324 4:165021195-165021217 TTGTCAGCAAACATCAAAAATGG - Intergenic
983354520 4:166638345-166638367 ATCTCAGCAAAAGCCAGGAATGG - Intergenic
983362274 4:166742019-166742041 AGCTCAGCAATATTCAGAAGCGG - Exonic
983400661 4:167261677-167261699 TTCTCAGGACAAATGAGAAATGG - Intergenic
983811296 4:172065598-172065620 TTCACAGCAAAATTAAGAGGAGG + Intronic
983913178 4:173263137-173263159 ACCTCACCAAACTTCAGAAAGGG + Intronic
984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG + Intergenic
984369263 4:178841081-178841103 TTCTCGGGAAAATTGTGAAAAGG - Intergenic
984545262 4:181093809-181093831 TTCTCAGCAAACTTTCGCAAGGG - Intergenic
984739642 4:183148530-183148552 TTCTCTGCTTAAATCAGAAATGG + Intronic
984822232 4:183892125-183892147 GTCTTAGCAAAATTCTGAAAAGG + Intronic
986272232 5:6243348-6243370 CTCCAAGCAAAATTCAGCAAAGG - Intergenic
986353326 5:6900807-6900829 TTCTCTGAAAAATTGATAAAGGG - Intergenic
986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG + Intergenic
987178895 5:15345982-15346004 TCCTAAGTAAAATGCAGAAATGG + Intergenic
987194297 5:15509956-15509978 TACCCAGGAAAATTCAGAGATGG - Intronic
987385280 5:17323140-17323162 TTCTAGGCAAAGTTCAGAAGAGG - Intergenic
987576452 5:19734499-19734521 TCCTCAGAAAAATTCACCAAAGG + Intronic
987707717 5:21476698-21476720 TCCTCAGCAAAATTCTGACCAGG - Intergenic
987858903 5:23458170-23458192 TTCTCAGAAAACTTTAGATATGG + Intergenic
987958839 5:24777070-24777092 TTTTCAGAAAAATATAGAAAAGG + Intergenic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
990164657 5:52981350-52981372 TTCTGAGCCAGATTCAGAAATGG + Intergenic
990361595 5:55026660-55026682 CTCTCAGCAAAATTTTGAAGAGG + Intronic
990473540 5:56140323-56140345 TTAGCAGTAAAATTCAGAAGTGG - Intronic
991037650 5:62144213-62144235 TTCTCTAGAAAAATCAGAAAGGG + Intergenic
992509922 5:77422540-77422562 TTCTGAGCAAAATTAACAAAGGG + Intronic
993356729 5:86920073-86920095 TTTTCTGGAAAATACAGAAAAGG + Intergenic
994561063 5:101373072-101373094 TTTTGAGCAAAATCCAGAAATGG + Intergenic
994878337 5:105452980-105453002 TACTCAGTGAAATTCAGGAAAGG + Intergenic
995433553 5:112109619-112109641 TTCTCAGGAAAAATCTGTAAGGG - Intergenic
995602384 5:113811969-113811991 TTGTCAACAGAATTCAGAAAAGG + Intergenic
996035285 5:118751768-118751790 TGCTTAGCAAAATGCATAAAGGG + Intergenic
996213759 5:120842817-120842839 TTCTCCTCATAATTAAGAAAGGG - Intergenic
996271114 5:121605698-121605720 TTCTCAGCCAAATTCACCAGAGG + Intergenic
997814449 5:137002704-137002726 TTCTCACCTAAAATCAGCAATGG + Intronic
998381306 5:141727604-141727626 TTCTCTTCAAAATTCATAAGTGG - Intergenic
998415429 5:141942703-141942725 TTCTGATCAAAGTTCAGAACAGG + Intergenic
998438555 5:142136151-142136173 TTCAGAGCAAAATTCATCAAAGG - Intronic
998567715 5:143230970-143230992 TTGTCACGAAGATTCAGAAAAGG - Intergenic
998781608 5:145663044-145663066 TTCTCATGGAATTTCAGAAATGG + Intronic
998893917 5:146777731-146777753 TTCTATGCACAATTGAGAAAAGG + Intronic
998975740 5:147644849-147644871 TACCAAGGAAAATTCAGAAATGG - Exonic
1000100473 5:158011651-158011673 TTCTCAGCACTATAGAGAAAGGG - Intergenic
1000219930 5:159204897-159204919 TTCTCAGCAAAATTCTTAAAAGG - Intronic
1000253864 5:159519708-159519730 TTCTCAGGCTAAGTCAGAAAGGG - Intergenic
1000913724 5:167053913-167053935 TTCATAGCAAAATTGAGCAAAGG + Intergenic
1004226984 6:13794500-13794522 GTCTCAACAAAAGACAGAAAAGG + Intronic
1005129330 6:22486528-22486550 TTCACAGCAAAATTCATCAAAGG - Intergenic
1006089216 6:31618168-31618190 TTTGCAGCAAAATTCTTAAAAGG - Intergenic
1007087695 6:39160962-39160984 ATCTCAGCAAGATGCAGAAAAGG + Intergenic
1007988977 6:46235134-46235156 AAATCAGCAAAATTCAGACAAGG + Intronic
1008528302 6:52430382-52430404 TTCTCAGCAAAATTGATACAAGG - Intronic
1008778048 6:55064918-55064940 TTCTTAGCAAGGTTCTGAAAGGG - Intergenic
1009607459 6:65891886-65891908 TTCTCACCATAATTCAGTAGTGG + Intergenic
1010215362 6:73396243-73396265 TTTTCAAAAAAATTCAGAAATGG - Intronic
1010865454 6:80971167-80971189 TTCTGAGAAAGTTTCAGAAATGG + Intergenic
1010897521 6:81382734-81382756 TTTTCAGCAAAATTAAGGATAGG - Intergenic
1011057035 6:83216497-83216519 TTCTCTGAAAATTGCAGAAAAGG - Exonic
1011673961 6:89713187-89713209 TTCCCAGCATGCTTCAGAAAAGG + Exonic
1011915288 6:92497115-92497137 TACTTATCAAAATTCAGAACAGG + Intergenic
1012637598 6:101564353-101564375 TTCACAGCAAAATTAAGATCAGG + Intronic
1012896170 6:104952595-104952617 TTTACAACAAAATTCAGAAAAGG - Intergenic
1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG + Intronic
1013690589 6:112637504-112637526 TTCTAAGCAGAATTCCAAAATGG + Intergenic
1013790479 6:113830903-113830925 ATCTCAGCAAACACCAGAAATGG + Intergenic
1014008460 6:116448955-116448977 TTCATAGCAAAATTCAGAGAAGG + Intergenic
1014146931 6:118008655-118008677 TTCTAAGTAAATTCCAGAAAAGG - Intronic
1014458938 6:121671928-121671950 TAATCACTAAAATTCAGAAACGG + Intergenic
1014744129 6:125179882-125179904 TTCTAAGGAAAATTCAGGAGTGG + Intronic
1014898253 6:126930298-126930320 TTCTAGGAAAAATTCAGAGATGG + Intergenic
1015127771 6:129773366-129773388 TTATCAGGAAAGTTCAGCAAGGG + Intergenic
1015934266 6:138392514-138392536 ATGTAAGCAAAATTCAGACAAGG + Intergenic
1016654674 6:146504805-146504827 CTCTCAGCAAGATTCACAATAGG + Intergenic
1016660427 6:146571559-146571581 TTCTCAGCAGAATAGAGAATAGG + Intergenic
1017621436 6:156303383-156303405 TTCACAGCAAAACTAAGTAAAGG - Intergenic
1018220740 6:161576082-161576104 CTCTCAGACTAATTCAGAAATGG - Intronic
1018262232 6:161981967-161981989 TTCTCAGCAAAGTTGTGACATGG - Intronic
1019079548 6:169420943-169420965 TTCTCAGTAACAATGAGAAACGG + Intergenic
1019530637 7:1501492-1501514 TTCTCAGCAAAACAGAGAGATGG - Intronic
1019852526 7:3573782-3573804 TTCTCAGCATGACTTAGAAAAGG - Intronic
1020000491 7:4752960-4752982 TTCAGAACTAAATTCAGAAAAGG + Intronic
1020342136 7:7123565-7123587 TTCTCAGTGAATTTCAGAAATGG + Intergenic
1020526519 7:9266925-9266947 TTCTCAGAGAAACTCTGAAAGGG - Intergenic
1020637149 7:10711072-10711094 TTTACAGCAAAATTTAGTAAAGG - Intergenic
1020718388 7:11708979-11709001 TTATAAGGAAAATTTAGAAAAGG + Intronic
1020853969 7:13393623-13393645 TTCTCAGAACAATTCCAAAAGGG - Intergenic
1021265341 7:18513984-18514006 TTCTAAGCCAAAGTCAGACATGG - Intronic
1021384438 7:20010498-20010520 TTCTTAAGAAAATTCAGAAGAGG - Intergenic
1021437850 7:20641708-20641730 TTCTCAGCAAGAATCATGAAAGG + Intronic
1021561975 7:21977342-21977364 TTCTCAGCAAACTATAGCAAGGG - Intergenic
1021710164 7:23408173-23408195 TTCTCACAAAAATTGAGGAAGGG + Intronic
1022797605 7:33744571-33744593 TACATAGCAAAATTTAGAAAAGG - Intergenic
1023146755 7:37159031-37159053 TTCTCAGCAAAATTATCACAAGG + Intronic
1023549001 7:41348784-41348806 TCCTCAGCAGAAGTTAGAAAAGG - Intergenic
1023604993 7:41921942-41921964 TTCTCAACCATATTCAGCAATGG - Intergenic
1024103476 7:46057831-46057853 TTCTAAGAAAAATTTAGAAAAGG - Intergenic
1024881150 7:54087045-54087067 TTCTCAGCCACATTCAGATATGG + Intergenic
1025074296 7:55929223-55929245 TTATCAAGAAAATTCTGAAAAGG + Intronic
1026443989 7:70468266-70468288 TTCTGATCAAGATTAAGAAAAGG + Intronic
1026940530 7:74285282-74285304 GTTGCAGAAAAATTCAGAAAAGG + Intergenic
1027499271 7:78927781-78927803 TTCTGGACAAAATTCAGAAATGG - Intronic
1028269223 7:88767425-88767447 TTCACAGCAAAATAAAGAACTGG - Intronic
1028275006 7:88844710-88844732 TTCACAGCAAGATTCAGACGGGG - Intronic
1028279960 7:88911811-88911833 ATAACAACAAAATTCAGAAAAGG - Intronic
1028325093 7:89513853-89513875 TACTAAGCAAAAGTCAGCAAGGG + Intergenic
1029019813 7:97352612-97352634 TGCTTAGCAAATTGCAGAAAAGG - Intergenic
1030412167 7:109194523-109194545 CTCTTAGTAAAATACAGAAATGG - Intergenic
1030494104 7:110275078-110275100 TCCTCAGCACTTTTCAGAAATGG - Intergenic
1031115516 7:117663647-117663669 TTCAGAGATAAATTCAGAAATGG - Intronic
1031349602 7:120713574-120713596 TTCTTAGCAAAATTCAAGCAGGG + Intronic
1031412127 7:121452114-121452136 TTTACAGCAAAATTCCAAAAAGG + Intergenic
1031766882 7:125790068-125790090 AACTCAGCAAAATTAAGAACAGG + Intergenic
1032328727 7:130957187-130957209 TTCAGAGCAAAAATAAGAAAAGG + Intergenic
1033357951 7:140616054-140616076 TTCTCAAGAAATTTCAGAATAGG + Intronic
1034589317 7:152126707-152126729 TTCTCAGGAAATTGCAGGAAAGG + Intergenic
1036094660 8:5710523-5710545 TTCTGAGCAACACTCAGAACAGG - Intergenic
1037750085 8:21675954-21675976 TTCACAGCAAACTTCAGAGACGG + Intergenic
1037806732 8:22062057-22062079 TTCCCAGCAAAAGTGAGAGATGG - Intronic
1038094899 8:24297408-24297430 TTCTCAGCACCATTCAGAAATGG - Intronic
1040400045 8:47041050-47041072 TTCTCAGAAGGTTTCAGAAAAGG - Intergenic
1040731229 8:50449476-50449498 GTCTCAGCAAAATTCTAAACAGG + Intronic
1041125051 8:54628511-54628533 TTCTAAGCAAAATAGTGAAAAGG + Exonic
1041905901 8:63033111-63033133 TTCACAGCAAAATTAAGAGAAGG + Intronic
1041994750 8:64040547-64040569 TTCTCAGATAAATGCAGCAAAGG + Intergenic
1042626902 8:70768302-70768324 TTCTCAGCAAATGTAAAAAATGG - Intronic
1043679721 8:83008190-83008212 TTGTCAGCAGAAATCAGAGATGG - Intergenic
1043908004 8:85829940-85829962 TCCTCATAAAAATTCAGGAAAGG + Intergenic
1046120075 8:109835240-109835262 TTCGCAGCAAAATTGAGAGGAGG + Intergenic
1046140650 8:110085863-110085885 TTCTCAACAAATTAAAGAAAAGG + Intergenic
1046193246 8:110827052-110827074 TTCTTAGAAAAATTCAAACAAGG - Intergenic
1046403163 8:113734495-113734517 AGATCAGCAAATTTCAGAAATGG + Intergenic
1046501652 8:115085502-115085524 TTCTCACCTAAAATCAGAGAAGG + Intergenic
1046781228 8:118217435-118217457 TTCTGAGGAAGATTCAGAACTGG + Intronic
1046801298 8:118430974-118430996 TACTCAGTTAAAATCAGAAAAGG - Intronic
1047050238 8:121103232-121103254 ACCTCAGCAAACATCAGAAAAGG + Intergenic
1047330533 8:123883007-123883029 TTCACAGCAAACCTGAGAAAAGG - Intronic
1047849790 8:128844270-128844292 TTCTGAGCAATACTCAGAAGAGG - Intergenic
1047939699 8:129817132-129817154 TTCACAAGAAAATTCAGAAGAGG + Intergenic
1048032057 8:130642114-130642136 TTCTCAGCAAAATTGAAATATGG + Intergenic
1048411478 8:134178546-134178568 TTCTCAGCATAATTCAACTAGGG + Intergenic
1051209871 9:14730052-14730074 TTGTCAGCAACTTTGAGAAAAGG + Intergenic
1051850081 9:21496097-21496119 CTGTAAGCAAAATACAGAAACGG - Intergenic
1051885730 9:21890570-21890592 TTGTGAGAAAAAGTCAGAAATGG + Intronic
1052085190 9:24256483-24256505 TTCTGAGGAAAATTAAGGAAGGG + Intergenic
1052545800 9:29876504-29876526 TTCTCAGAAAATATCATAAAAGG + Intergenic
1053025544 9:34725684-34725706 TACTCAGCCAGAGTCAGAAATGG + Exonic
1053037074 9:34834746-34834768 TACTCAGCCAGAGTCAGAAATGG + Intergenic
1053086527 9:35228268-35228290 TTCTGAGAAAAAGTCGGAAAAGG - Intronic
1055017222 9:71631893-71631915 TTATCATCTAAATTCAGTAAGGG + Intergenic
1055174084 9:73296617-73296639 TTCTCAACAACCTACAGAAAAGG + Intergenic
1055717062 9:79129409-79129431 TTTTATTCAAAATTCAGAAAGGG - Intergenic
1056434030 9:86557709-86557731 GGCTCAGCAAAAGTCAGTAAAGG + Intergenic
1056908024 9:90671335-90671357 TCCACAGCAAAATTCAAGAAAGG + Intergenic
1057991971 9:99779961-99779983 TTCACATCAAAATTAAGAGAAGG - Intergenic
1058097695 9:100881758-100881780 TTCTCAAGAAATTTCAGGAAGGG - Intergenic
1058173226 9:101707810-101707832 TTCCCAGGACAATTCTGAAAGGG - Intronic
1058227075 9:102378301-102378323 TTCACAGCAAAATTTTCAAAGGG - Intergenic
1058247711 9:102650865-102650887 TTCTGAACAAGATTCAAAAACGG + Intergenic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1058980348 9:110163121-110163143 TTCTCAGCAAAAAGAAAAAATGG - Intronic
1061227271 9:129288049-129288071 TTCTCACCGAGATTCAGAGAGGG + Intergenic
1186634594 X:11388779-11388801 TTCTCAACTAAACTCAGAAAAGG + Intronic
1187094456 X:16131747-16131769 TTCTCAGCAATAAAAAGAAATGG - Intronic
1187197246 X:17099526-17099548 TTCTCAGCAAAGTGCAGAAAAGG + Intronic
1187216644 X:17283324-17283346 TTCTCAGCAAAGTGCAACAAAGG - Intergenic
1187893151 X:23956044-23956066 ATCCTAGCAAAAGTCAGAAAAGG - Intergenic
1189067154 X:37822425-37822447 TTCTTATCAAAATTTAGAAGAGG - Intronic
1189103001 X:38210439-38210461 TTCCCAGAGACATTCAGAAATGG - Intronic
1189720312 X:43909160-43909182 TTCTCAGTAAAATTCACCTAGGG - Intergenic
1190976293 X:55404729-55404751 TTCAAGGCAAAATTCAGTAAAGG - Intergenic
1191001068 X:55660156-55660178 ATCTCAGCAGAATGCAGAGAAGG + Intergenic
1191675272 X:63786016-63786038 TTCTCAGCAAAATAAGCAAATGG - Intergenic
1192355956 X:70404143-70404165 TTATTTGCAAAATTTAGAAAAGG - Intronic
1193408510 X:81134208-81134230 TTGTAACCAAAATTGAGAAATGG - Intronic
1193819153 X:86141162-86141184 ATTTCAGCAAAACTCAGAGAAGG + Intergenic
1194498741 X:94653841-94653863 TTTTAAGCAAAAATCATAAAAGG - Intergenic
1196249057 X:113436813-113436835 TTCACAGCAAAATTGAGTGAAGG + Intergenic
1197314850 X:124953004-124953026 TTCTCATTATAATTCTGAAAGGG - Intronic
1197657413 X:129132130-129132152 TTCTTATCAAAATTCTGCAATGG - Intergenic
1198025907 X:132706856-132706878 AGCTCACCAAAATTCAAAAAGGG + Intronic
1198672965 X:139101174-139101196 TTCTCAGCAGCAGTCAGAATTGG - Intronic
1199075324 X:143518824-143518846 TTCTAATCAAAATTCTAAAAAGG + Intergenic
1199251469 X:145667345-145667367 TTTTAAGCAAAAATCATAAAAGG - Intergenic
1199534462 X:148886412-148886434 TTCTCAGCTGCATTCTGAAATGG - Intronic
1201694658 Y:16811612-16811634 TTCTATGCAATATTCAAAAAGGG - Intergenic